#NEXUS 
[MacClade 4.0 registered to Dan Nickrent, SIUC]
[New Arborescent Santalaceae from Madagascar, by Zachary S. Rogers, Daniel L. Nickrent, and Valéry Malécot. Submitted to Bot. J. Linn. Soc.]


BEGIN DATA;
DIMENSIONS NTAX=11 NCHAR=5694;
FORMAT DATATYPE=DNA MISSING=? GAP=- INTERLEAVE ;
MATRIX

[ 10 20 30 40 50]
[ . . . . .]

AcanAs4051 ---------CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATG [41]
AcanFa4053 -------------------------------------------------- [0]
CervTo4273 ---------CCTGCCAGTACTCATATGCTTGTCTCAAAGATTAAGCCATG [41]
JodiRh4052 ---------CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATG [41]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 ------------------------------------------AAGCCATG [8]
StauCa4956 -------------------------------------------------- [0]
PilgMa4954 -------------------------------------------------- [0]
PyruPu2737 TTGGTTGATCCTGCCAGTMGTCATATGCTTGTCTCAAAGATTAAGCCATG [50]
BuckDi2735 --GGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATG [48]
ComaUm2738 -TGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATG [49]

[ 60 70 80 90 100]
[ . . . . .]

AcanAs4051 CATGTGTAAGTATGAACAAATTCAGACTGTGAAACTGCGAATGGCTCATT [91]
AcanFa4053 ----------TATGAACAAATTCAGACTGTGAAACTGCGAATGGCTCATT [40]
CervTo4273 CATGTGTAAGTATGAACAAATTCAGACTGTGAAACTGCGAATGGCTCATT [91]
JodiRh4052 CATGTGTAAGTATGAACAAATTCAGACTGTGAAACTGCGAATGGCTCATT [91]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 CATGTGTAAGTATGAACAAATTCAGACTGTGAAACTGCGAATGGCTCATT [58]
StauCa4956 ------TAAGTATGAACAAATTCAGACTGTGAAACTGCGAATGGCTCATT [44]
PilgMa4954 -------------------------------------------------- [0]
PyruPu2737 CATGTGTAAGTATGAACCAATTCAGACTGTGATACTGCGAATGGCTCATT [100]
BuckDi2735 CATGTGTAAGTATGAACAAATTCAAACTGTGAAACTGCGAATGGCTCATT [98]
ComaUm2738 CATGTGTAAGTCTGAACTAATTCAGACTGTGAAACTGCGAATGGCTCATT [99]

[ 110 120 130 140 150]
[ . . . . .]

AcanAs4051 AAATCAGTTATAGTTTGTTTGATGGTATCTTCTACTCGGATAACCGTAGT [141]
AcanFa4053 AAATCAGTTATAGTTTGTTTGATGGTATCTTCTACTCGGATAACCGTAGT [90]
CervTo4273 AAATCAGTTATAGTTTGTTTGATGGTATCTTCTACTCGGATAACCGTAGT [141]
JodiRh4052 AAATCAGTTATAGTTTGTTTGATGGTATCTTCTACTCGGATAACCGTAGT [141]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 AAATCAGTTATAGTTTGTTTGATGGTATCTTCTACTCGGATAACCGTAGT [108]
StauCa4956 AAATCAGTTATAGTTTGTTTGATGGTATCTTCTACTCGGATAACCGTAGT [94]
PilgMa4954 ----------------GTTTGATGGTATCTTCTACTCGGATAACCGTAGT [34]
PyruPu2737 RRATCAGTTATAGTTTGTTTGATGGTATCTTCTACTCGGATAACCGTAGT [150]
BuckDi2735 AAATCAGTTATAGTTTGTTTGATGGTATCTACTACTCGGATAACCGTAGT [148]
ComaUm2738 AAATCAGTTATAGTTTGTTTGATGGTATCTACTACTCGGATAACCGTAGT [149]

[ 160 170 180 190 200]
[ . . . . .]

AcanAs4051 AATTCTAGAGCTAATACGTGCAACAAACCCCGACTCTTGGAAGGGAAGCA [191]
AcanFa4053 AATTCTAGAGCTAATACGTGCAACAAACCCCGACTTTTGGAAGGGAAGCA [140]
CervTo4273 AATTCTAGAGCTAATACGTGCAACAAACCCCGACTCTTGGAAGGGAAGCA [191]
JodiRh4052 AATTCTAGAGCTAATACGTGCAACAAACCCCGACTCTTGGAAGGGAAGCA [191]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 AATTCTAGAGCTAATACGTGCAACAAACCCCGACTCTTGGAAGGGAAGCA [158]
StauCa4956 AATTCTAGAGCTAATACGTGCAACAAACCCCGACTCTTGGAAGGGAAGCA [144]
PilgMa4954 AATTCTAGAGCTAATACGTGCAACAAACCCCGACTCTTGGAAGGGAAGCA [84]
PyruPu2737 AATTCTAGAGCTAATACGTGCAACAAACCCCGACTCTTGGAAGGGAAGCA [200]
BuckDi2735 AATTCTAGAGCTAATACGTGCAACAAACCTCGACTCTTGGAAGGGAAGCA [198]
ComaUm2738 AATTCTAGAGCTAATACGTGCGACAGAGCCTGACCTTTGGAAGGGAAGCA [199]

[ 210 220 230 240 250]
[ . . . . .]

AcanAs4051 TTTATTAGATAAAAGGTCGACGCGGGCTTTGGCTCGTTGCTCTGATGATT [241]
AcanFa4053 TTTATTAGATAAAAGGTCGACGCGGGCTTT-GCCCGTTGCTCTGATGATT [189]
CervTo4273 TTTATTAGATAAAAGGTCGACGCGGGCTTC-GCTCGTTGCTCTGATGATT [240]
JodiRh4052 TTTATTAGATAAAAGGTCGACGCGGGCTTA-GCTCGTTGCTCTGATGATT [240]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TTTATTAGATAAAAGGTCAACGCGGGCTAT-GCCCGTTGCTCTGATGATT [207]
StauCa4956 TTTATTAGATAAAAGGTCAACGCGGGCTAT-GCCCGTTGCTCTGATGATT [193]
PilgMa4954 TTTATTAGATAAAAGGTCAACGCGGGCTTT-GCCCGTTGCTCTGATGATT [133]
PyruPu2737 TTTATTAGATAAAAGGTCGACGCGG-CTTT-GCCCGTTGCTTCGATGATT [248]
BuckDi2735 TTTATTAGATAAAAGGTCGACGGCAGCTTT-GCTCGTTGCTCTRATRATT [247]
ComaUm2738 TTTATTAGATAAAAGGTCGGCCGGG-CTTC-GCTCGCTGCTCTGATGATT [247]

[ 260 270 280 290 300]
[ . . . . .]

AcanAs4051 CATGATAACTCGACGGATCGCACGGCCCTTGTGCCGGCGACGCATCATTC [291]
AcanFa4053 CATGATAACTCGACGGATCGCACGGCCCTTGTGCCGGCGACGCATCATTC [239]
CervTo4273 CATGATAACTCGACGGATCGCACGGCCCTTGTGCCGGCGACGCATCATTC [290]
JodiRh4052 CATGATAACTCGACGGATCGCACGGCCCTTGTGCCGGCGACGCATCATTC [290]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 CATGATAACTCGACGGATCGCACGGCCTTTGTGCCGGCGACGCATCATTC [257]
StauCa4956 CATGATAACTCGACGGATCGCACGGCCTTTGTGCCGGCGACGCATCATTC [243]
PilgMa4954 CATGATAACTCGACGGATCGCACGGCCCTTGTGCCGGCGACGCATCATTC [183]
PyruPu2737 CATGATAACTCGACGGATCGCACGGCCTTTGTGCCGGCGACGCATCATTC [298]
BuckDi2735 CAT-ATAACTCGACGGATCGCACGGCCTTTGTGCTGGCGACGCATCATTC [296]
ComaUm2738 CATGATAACTCGACGGATCGCATGGCCGTGGTGCTGGCGACGCATCATTC [297]

[ 310 320 330 340 350]
[ . . . . .]

AcanAs4051 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACTATGGT [341]
AcanFa4053 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACTATGGT [289]
CervTo4273 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACTATGGT [340]
JodiRh4052 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACTATGGT [340]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATATTGGCCTACTATGGT [307]
StauCa4956 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATATTGGCCTACTATGGT [293]
PilgMa4954 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATATTGGCCTACTATGGT [233]
PyruPu2737 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATATTGGCCTACTATGGT [348]
BuckDi2735 AAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACTATGGT [346]
ComaUm2738 GAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACTATGGT [347]

[ 360 370 380 390 400]
[ . . . . .]

AcanAs4051 GTTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [391]
AcanFa4053 GTTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [339]
CervTo4273 GTTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [390]
JodiRh4052 GTTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [390]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GTTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [357]
StauCa4956 GTTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [343]
PilgMa4954 ATTTACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [283]
PyruPu2737 GTTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [398]
BuckDi2735 GGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [396]
ComaUm2738 GGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAG [397]

[ 410 420 430 440 450]
[ . . . . .]

AcanAs4051 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [441]
AcanFa4053 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [389]
CervTo4273 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [440]
JodiRh4052 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [440]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [407]
StauCa4956 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [393]
PilgMa4954 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [333]
PyruPu2737 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [448]
BuckDi2735 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [446]
ComaUm2738 AAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC [447]

[ 460 470 480 490 500]
[ . . . . .]

AcanAs4051 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTTTTTTGAG [491]
AcanFa4053 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTTTTTTGAG [439]
CervTo4273 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTTTTTTGAG [490]
JodiRh4052 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTTTTTTGAG [490]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTCTTTCGAG [457]
StauCa4956 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTCTTTCGAG [443]
PilgMa4954 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTCTTTCGAG [383]
PyruPu2737 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTCTTTCGAG [498]
BuckDi2735 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTTCTTTGAG [496]
ComaUm2738 CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCTCACATGAG [497]

[ 510 520 530 540 550]
[ . . . . .]

AcanAs4051 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [541]
AcanFa4053 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [489]
CervTo4273 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [540]
JodiRh4052 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [540]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [507]
StauCa4956 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [493]
PilgMa4954 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [433]
PyruPu2737 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [548]
BuckDi2735 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [546]
ComaUm2738 TCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG [547]

[ 560 570 580 590 600]
[ . . . . .]

AcanAs4051 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [590]
AcanFa4053 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [538]
CervTo4273 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [589]
JodiRh4052 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [589]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [556]
StauCa4956 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [542]
PilgMa4954 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [482]
PyruPu2737 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [597]
BuckDi2735 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGTTAATTCCAGCTCCAATAGCG [596]
ComaUm2738 GAGGGCAAGTCTGGTGCCAGCAGCCGCGGT-AATTCCAGCTCCAATAGCG [596]

[ 610 620 630 640 650]
[ . . . . .]

AcanAs4051 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [640]
AcanFa4053 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [588]
CervTo4273 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGTTGG [639]
JodiRh4052 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [639]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [606]
StauCa4956 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [592]
PilgMa4954 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [532]
PyruPu2737 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [647]
BuckDi2735 TATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [646]
ComaUm2738 TCTCTTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTTGGGTTGG [646]

[ 660 670 680 690 700]
[ . . . . .]

AcanAs4051 GATAATCGGTCAGCCACCAGGTGTGTACCGGTTGTCCNGTCCCTTCTACC [690]
AcanFa4053 GATAATCGGTCAGCCACCAGGTGTGTACCGGTTGTCCCGTCCCTTCTACC [638]
CervTo4273 GATAATCGGTCAGCCACCAGGTGTGTACCGGTTGTCCCGTCCCTTCTACC [689]
JodiRh4052 GATAATCGGTCAGCCATCAGGTGTGTACCGGTTGTCCCGTCCCTTCTACC [689]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GGTAATCGGTCAGCCTCTAGGTGTGTACCGGTTGTCCCGTCCCTTCTACC [656]
StauCa4956 GGTAATCGGTCAGCCTCTAGGTGTGTACCGGTTGTCCCGTCCCTTCTACC [642]
PilgMa4954 GGTAATCGGTCAGCCTCTAGGTGTGTACCGGTTGTCCCGTCCCTTCTACC [582]
PyruPu2737 GATAATCGGTCAGCCTCTAGGTGTGTACCGGTTGTCCCGTCCCTATTACC [697]
BuckDi2735 GTCGATCGGTCGGCCTCTGGGCGTGTACCGGTTGATTGAACCCTTCTACC [696]
ComaUm2738 GGTGGTCGGTCCGCCTCTCGGTGTGTACCGGCTGTCTCGTCCCTTCTACC [696]

[ 710 720 730 740 750]
[ . . . . .]

AcanAs4051 GGCGTTGCGCTCCTGGCCTTAATTGGCCGGGTCGTGTCTCCGGTGCTGTT [740]
AcanFa4053 GGCGTTGCGCTCCTGGCCTTAATTGGCCGGGTCGTGTCTCCGGTGCTGTT [688]
CervTo4273 GGCGTTGCGCTCCTGGCCTTAATTGGCCGGGTCGTGTCTTCGGTGCTGTT [739]
JodiRh4052 GGCGTTGCGCTCCTGTCCTTAATTGGCCGGGTCGTGTCTCCGGTGCTGTT [739]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GGCGTTGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTT [706]
StauCa4956 GGCGTTGCGCTCCTGGTCTTAATTGGCCGGGTCGTGCCTCCGGTGCTGTT [692]
PilgMa4954 GGCGTTGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTT [632]
PyruPu2737 GGCGTTGCGCTCCTGGCCTTAACTGGCCGGGTCGTGCCTCCGGTGCTGTT [747]
BuckDi2735 GGCGATGCGCTCCTGKCCTTAGCTGGCCGGGTCGTGC-TTCGGTGCTGTT [745]
ComaUm2738 GGCGATGCGCTCCTAGCCTTAATTGGTCGGGTCGTGCCTCCGGTGCTGTT [746]

[ 760 770 780 790 800]
[ . . . . .]

AcanAs4051 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTAAGCTCTGGATACATT [790]
AcanFa4053 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTAAGCTCTGGATACATT [738]
CervTo4273 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATT [789]
JodiRh4052 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATT [789]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATT [756]
StauCa4956 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATT [742]
PilgMa4954 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATT [682]
PyruPu2737 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGGATACATT [797]
BuckDi2735 ACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCTACGCTCTGTACACATT [795]
ComaUm2738 ACTTTGAAGAAATTAGAGTGCTCAAAGCATGCCTACGCTCTGTATACATT [796]

[ 810 820 830 840 850]
[ . . . . .]

AcanAs4051 AGCATGGGATAACATCATAGGATTTCGGTCCTATTCTGTTGGCCTTCGGG [840]
AcanFa4053 AGCATGGGATAACATCATAGGATTTCGGTCCTATTCTGTTGGCCTTCGGG [788]
CervTo4273 AGCATGGGATAACATCATAGGATTTCGGTCCTATTCTGTTGGCCTTCGGG [839]
JodiRh4052 AGCATGGGATAACATCATAGGATTTCGGTCCTATTCTGTTGGCCTTCGGG [839]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 AGCATGGGATAACATCATAGGATTTCGGTCCTATTCTGTTGGCCTTCGGG [806]
StauCa4956 AGCATGGGATAACATCATAGGATTTCGGTCCTATTCTGTTGGCCTTCGGG [792]
PilgMa4954 AGCATGGGATAACATCATAGGATTTCGGTCCTATTCTGTTGGCCTTCGGG [732]
PyruPu2737 AGCATGGGATAACATCATAGGATTTCGGTCCTATTCTGTCGGCCTTCGGG [847]
BuckDi2735 AGCATGGGATAACATCATAGCATTTCGGTCCTATTCTGTTGGCCTTCGGG [845]
ComaUm2738 AGCATGGGATGACATCATAGGATTTCGGTCCTTTTTTGTTGGCCTTCGGG [846]

[ 860 870 880 890 900]
[ . . . . .]

AcanAs4051 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [890]
AcanFa4053 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [838]
CervTo4273 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [889]
JodiRh4052 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [889]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [856]
StauCa4956 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [842]
PilgMa4954 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [782]
PyruPu2737 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [897]
BuckDi2735 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGT [895]
ComaUm2738 ATCGGAGTAATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCGTAGT [896]

[ 910 920 930 940 950]
[ . . . . .]

AcanAs4051 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [940]
AcanFa4053 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [888]
CervTo4273 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [939]
JodiRh4052 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [939]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [906]
StauCa4956 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [892]
PilgMa4954 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [832]
PyruPu2737 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [947]
BuckDi2735 CAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATT [945]
ComaUm2738 CAGAGGTGAAATTCTTGGATTTATGAAAGACGGACAACTGCGAAAGCATT [946]

[ 960 970 980 990 1000]
[ . . . . .]

AcanAs4051 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [990]
AcanFa4053 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [938]
CervTo4273 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [989]
JodiRh4052 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [989]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [956]
StauCa4956 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [942]
PilgMa4954 TGCCACGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [882]
PyruPu2737 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [997]
BuckDi2735 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [995]
ComaUm2738 TGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGAC [996]

[ 1010 1020 1030 1040 1050]
[ . . . . .]

AcanAs4051 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [1040]
AcanFa4053 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [988]
CervTo4273 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [1039]
JodiRh4052 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [1039]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [1006]
StauCa4956 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [992]
PilgMa4954 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGCTCA [932]
PyruPu2737 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [1047]
BuckDi2735 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [1045]
ComaUm2738 GATCAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACCAGGGATCA [1046]

[ 1060 1070 1080 1090 1100]
[ . . . . .]

AcanAs4051 GCGGATGTTGCTTTCAGGACTCCGCTGGCACCTTATGAGAAATCAAAGTT [1090]
AcanFa4053 GCGGATGTTGCTTTCAGGACTCCGCTGGCACCTTATGAGAAATCAAAGTT [1038]
CervTo4273 GCGGATGTTGCTTTCAGGACTCCGCTGGCACCTTATGAGAAATCAAAGTT [1089]
JodiRh4052 GCGGATGTTGCTTTCAGGACTCCGCTGGCACCTTATGAGAAATCAAAGTT [1089]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GTGGATGTTGCTTTCAGGACTCCGCTGGCACCTTATGAGAAATCAAAGTT [1056]
StauCa4956 GTGGATGTTGCTTTCAGGACTCCGCTGGCACCTTATGAGAAATCAAAGTT [1042]
PilgMa4954 GCGGATGTTGCTTTCAGGACTCCGCTGGTACCTTATGAGAAATCAAAGTT [982]
PyruPu2737 GCGGATGTTGCTTTCAGGACTCTGCTGGTACCTTATGAGAAATCAAAGTT [1097]
BuckDi2735 GCGGAAGTTGCTTTTAGGACTTCGCTGGCAGCTTATGAGAAATCAAAGTC [1095]
ComaUm2738 GCGGGTGTTGCTTTTAGGACTCTGCTGGCACCTTATGAGAAATCAAAGTT [1096]

[ 1110 1120 1130 1140 1150]
[ . . . . .]

AcanAs4051 TTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1140]
AcanFa4053 TTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1088]
CervTo4273 TTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1139]
JodiRh4052 TTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1139]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1106]
StauCa4956 TCTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1092]
PilgMa4954 TTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1032]
PyruPu2737 TTTGGGTTCYGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1147]
BuckDi2735 TTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1145]
ComaUm2738 TTCGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTG [1146]

[ 1160 1170 1180 1190 1200]
[ . . . . .]

AcanAs4051 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1190]
AcanFa4053 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1138]
CervTo4273 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1189]
JodiRh4052 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1189]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1156]
StauCa4956 ACGGAAGGGCTCCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1142]
PilgMa4954 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1082]
PyruPu2737 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1197]
BuckDi2735 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1195]
ComaUm2738 ACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACA [1196]

[ 1210 1220 1230 1240 1250]
[ . . . . .]

AcanAs4051 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1240]
AcanFa4053 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1188]
CervTo4273 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1239]
JodiRh4052 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1239]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1206]
StauCa4956 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1192]
PilgMa4954 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1132]
PyruPu2737 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1247]
BuckDi2735 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGATTGAGAGC [1245]
ComaUm2738 CGGGGAAACTTACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGC [1246]

[ 1260 1270 1280 1290 1300]
[ . . . . .]

AcanAs4051 TCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGA [1290]
AcanFa4053 TCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGA [1238]
CervTo4273 TCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGA [1289]
JodiRh4052 TCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGA [1289]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGA [1256]
StauCa4956 TCTTTCATGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGA [1242]
PilgMa4954 TCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGA [1182]
PyruPu2737 TCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTCGTTGGTGGA [1297]
BuckDi2735 TCTTTCAAGATTCTATGGGTGGTGGTGCATGGCCGTTGTTAGTTGGTGGA [1295]
ComaUm2738 TCTTTCTTGATTCTGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGA [1296]

[ 1310 1320 1330 1340 1350]
[ . . . . .]

AcanAs4051 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1340]
AcanFa4053 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1288]
CervTo4273 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1339]
JodiRh4052 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1339]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1306]
StauCa4956 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1292]
PilgMa4954 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1232]
PyruPu2737 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1347]
BuckDi2735 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC [1345]
ComaUm2738 GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCGGCCTGCTAAC [1346]

[ 1360 1370 1380 1390 1400]
[ . . . . .]

AcanAs4051 TAGCTAC-ATGGAGGT-GCCCCTCCATGGCTAGCTTCTTAGAGGGACTAT [1388]
AcanFa4053 TAGCTAC-ATGGAGGT-GCCCCTCCATGGCTAGCTTCTTAGAGGGACTAT [1336]
CervTo4273 TAGCTAC-ATGGAGGT-GCCCCTCCATGGCTAGCTTCTTAGAGGGACTAT [1387]
JodiRh4052 TAGCTAC-ATGGAGGT-GCCCCTCCATGGCTAGCTTCTTAGAGGGACTAT [1387]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TAGCTAC-ATGGAGGT-GCCCCTTCATGGCTAGCTTCTTAGAGGGACTAT [1354]
StauCa4956 TAGCTAC-ATGAAGGT-GCCCCTTCATGGCTAGCTTCTTAGAGGGACTAT [1340]
PilgMa4954 TAGCTAC-ATGGAGGT-GCCCCTTCATGGCTAGCTTCTTAGAGGGACTAT [1280]
PyruPu2737 TAGCTAC-ATGGAGGT-GCTCCTTCATGGCTAGCTTCTTAGAGGGACTAT [1395]
BuckDi2735 TAGCTAC-ATGGAGGT-GTCCCTTCATGGCTAGCTTCTTAGAGGGACTAT [1393]
ComaUm2738 TAGCTAC-GTGGAGGT-ACCCCTCCATGGCTAGCTTCTTAGAGGGACTAT [1394]

[ 1410 1420 1430 1440 1450]
[ . . . . .]

AcanAs4051 GGCGAACTAGGCCACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCT [1438]
AcanFa4053 GGCGAACTAGGCCACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCT [1386]
CervTo4273 GGCGAACTAGGCCACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCT [1437]
JodiRh4052 GGCGAACTAGGCCACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCT [1437]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GGCGTATTAGGCCACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCT [1404]
StauCa4956 GGCGTATTAGGCCACGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCT [1390]
PilgMa4954 GGCGTATTAGGCCACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCT [1330]
PyruPu2737 GGCGTATTAGGCCACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCT [1445]
BuckDi2735 GGCCTACTAGGCCACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCT [1443]
ComaUm2738 GGCCTTTTAGGCCACGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCT [1444]

[ 1460 1470 1480 1490 1500]
[ . . . . .]

AcanAs4051 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1488]
AcanFa4053 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1436]
CervTo4273 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1487]
JodiRh4052 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1487]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1454]
StauCa4956 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1440]
PilgMa4954 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1380]
PyruPu2737 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1495]
BuckDi2735 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTCTA [1493]
ComaUm2738 TAGATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAGCGAGTCTA [1494]

[ 1510 1520 1530 1540 1550]
[ . . . . .]

AcanAs4051 TAGCCTTGGCCGACAGGTCCGGGTAATCTTTGAAATTACATCGTGATGGG [1538]
AcanFa4053 TAGCCTTGGCCGACAGGTCCGGGTAATCTTTGAAATTACATCGTGATGGG [1486]
CervTo4273 TAGCCTTGGCCGACAGGTCCGGGTAATCTTTGAAATTACATCGTGATGGG [1537]
JodiRh4052 TAGCCTTGGCCGACAGGTCCGGGTAATCTTTGAAATTACATCGTGATGGG [1537]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TAGCCTTGGCCGACAGGTCCGGGTAATCTTTGAAATTACATCGTGATGGG [1504]
StauCa4956 TAGCCTTGGCCGACAGGTCCGGGTAATCTTTGAAATTCCATCGTGATGGG [1490]
PilgMa4954 TAGCCTTGGCCGACAGGTCCGGGTAATCTTTGAAATTACATCGTGATGGG [1430]
PyruPu2737 TAGCCTTGGCCGACAGGTCCGGGTAATCTTAGAAATTACATCGTGATGGG [1545]
BuckDi2735 TAACCTTGGCTGACAAGCCAGGGTAATCTTTGAAATTTCATCGTGATGGG [1543]
ComaUm2738 TGGCCTTGGCTGACAAGTCCGGGTAATCTTCGAAATTTCATCGTGATGGG [1544]

[ 1560 1570 1580 1590 1600]
[ . . . . .]

AcanAs4051 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1588]
AcanFa4053 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1536]
CervTo4273 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1587]
JodiRh4052 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1587]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1554]
StauCa4956 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1540]
PilgMa4954 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1480]
PyruPu2737 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1595]
BuckDi2735 GATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGC [1593]
ComaUm2738 GATAGATCATTGCAATTGTTGGTCTTGAACGAGGAATTCCTAGTAAGCGC [1594]

[ 1610 1620 1630 1640 1650]
[ . . . . .]

AcanAs4051 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1638]
AcanFa4053 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1586]
CervTo4273 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1637]
JodiRh4052 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1637]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1604]
StauCa4956 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1590]
PilgMa4954 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACAAACCGCCC [1530]
PyruPu2737 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1645]
BuckDi2735 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1643]
ComaUm2738 GAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCC [1644]

[ 1660 1670 1680 1690 1700]
[ . . . . .]

AcanAs4051 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGAGGCGAC [1688]
AcanFa4053 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGA---------- [1626]
CervTo4273 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGAGGCGAC [1687]
JodiRh4052 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGAGGCGAC [1687]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGAGGCGAC [1654]
StauCa4956 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGAGGCGAC [1640]
PilgMa4954 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGA---------- [1570]
PyruPu2737 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGAGGCGAC [1695]
BuckDi2735 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGCGGCGAC [1693]
ComaUm2738 GTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGAGGCGAT [1694]

[ 1710 1720 1730 1740 1750]
[ . . . . .]

AcanAs4051 GTGGGCGGTTCGCTGCC-GGCGACGTC-GCGAGAAGTCCACTGAACCTTA [1736]
AcanFa4053 -------------------------------------------------- [1626]
CervTo4273 GTGGGCGGTTCGCTGCC-GGCGACGTC-GCGAGAAGTCCAATGAACCTTA [1735]
JodiRh4052 GTGGGCGGTTCGCTGCC-GGCGACGTC-GCGAGAAGTCCACTGAACCTTA [1735]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GTGGGCGGTTCGCTGCC-GGCGACGTC-GCGAGAAGTCCACTGAACCTTA [1702]
StauCa4956 GTGGGCGGTTCGCTGCC-GGCGACGTC-GCGAGAAGTGCACTGAGCCTT- [1687]
PilgMa4954 -------------------------------------------------- [1570]
PyruPu2737 GTRGGCGGTTCGCTGCC-GGCGACGTASGCGAGAAGTCCACTGAACCTTA [1744]
BuckDi2735 GTGGGCGGTTCGCTGGCTGGCGATGTC-GTGAGAAGTCCACTGAACCTTA [1742]
ComaUm2738 GCGGGCGGTTCGCTGCC-GGCGACGTC-GCGAGAAGTCCACTGAACCTTA [1742]

[ 1760 1770 1780 1790 1800]
[ . . . . .]

AcanAs4051 T------------------------------------------------- [1737]
AcanFa4053 -------------------------------------------------- [1626]
CervTo4273 TCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGC [1785]
JodiRh4052 TCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGC [1785]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 TCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGC [1752]
StauCa4956 -------------------------------------------------- [1687]
PilgMa4954 -------------------------------------------------- [1570]
PyruPu2737 TCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGC [1794]
BuckDi2735 TCATTTAGAGGAAGGAGAAGTCG-AACAAGGTTTCCGTAGGTGAACCTGC [1791]
ComaUm2738 TCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGC [1792]

[ 1810 1820 1830 1840 1850]
[ . . . . .]

AcanAs4051 ---------------------------------AGTGTCGGATTCAAAGC [1754]
AcanFa4053 -------------------------------------TTGGATTCAAAGC [1639]
CervTo4273 GGAAGGATCATTG----------------------------------AGC [1801]
JodiRh4052 GGAAGGATCATTGCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGC [1835]
OkouAu4173 -------------------------------------------------- [0]
SclePe4347 GGAAGGATCATTG------------------------------------- [1765]
StauCa4956 -------------------------------------------------- [1687]
PilgMa4954 -----------------------------AGCAAGTGTTGGATTCAAAGC [1591]
PyruPu2737 GGAAGGATCATTG-------------TAAAGCAAGTGTTGGATTCAAAGC [1831]
BuckDi2735 GGAAGGATCATTG------------CTAAAGCAAGTGTTGGATTCAAAGC [1829]
ComaUm2738 GGAAGGATCATTG----------------------------ATTCAAAGC [1814]

[ 1860 1870 1880 1890 1900]
[ . . . . .]

AcanAs4051 TGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTATGAAACCA [1804]
AcanFa4053 TGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTTGCAAACCA [1689]
CervTo4273 TGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCA [1851]
JodiRh4052 TGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTATGAAACCA [1885]
OkouAu4173 ----GTTAAAGATTACAAATTAACTTATTATACTCCTGATTATGAAACCA [46]
SclePe4347 -------------------------------------------------- [1765]
StauCa4956 -------------------------------------------------- [1687]
PilgMa4954 TGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGATTATGAAACCA [1641]
PyruPu2737 TGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGATTATGAAACCA [1881]
BuckDi2735 GGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGATTACGAAACCA [1879]
ComaUm2738 TGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCA [1864]

[ 1910 1920 1930 1940 1950]
[ . . . . .]

AcanAs4051 AAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT [1854]
AcanFa4053 AAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT [1739]
CervTo4273 AAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT [1901]
JodiRh4052 AAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT [1935]
OkouAu4173 AAGATACTGATATCTTGGCAGCATTCCGAGTAACCCCTCAACCTGGAGTT [96]
SclePe4347 ------------TCTTAGCAGCATTCCGAGTAACCCCTCAACCTGGAGTT [1803]
StauCa4956 -------------------------------------------------- [1687]
PilgMa4954 AAGATACTGATATCTTAGCAGCATTTCGAGTAACTCCTCAACCTGGAGTT [1691]
PyruPu2737 AAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT [1931]
BuckDi2735 AAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTT [1929]
ComaUm2738 AGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT [1914]

[ 1960 1970 1980 1990 2000]
[ . . . . .]

AcanAs4051 CCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [1904]
AcanFa4053 CCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [1789]
CervTo4273 CCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [1951]
JodiRh4052 CCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [1985]
OkouAu4173 CCGCCCGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [146]
SclePe4347 CCGCCCGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [1853]
StauCa4956 ----------AAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [1727]
PilgMa4954 CCGCCCGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [1741]
PyruPu2737 CCGCCCGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTAC [1981]
BuckDi2735 CCACCTGAGGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACCGGTAC [1979]
ComaUm2738 CCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTAC [1964]

[ 2010 2020 2030 2040 2050]
[ . . . . .]

AcanAs4051 ATGGACATCTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [1954]
AcanFa4053 ATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [1839]
CervTo4273 ATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [2001]
JodiRh4052 ATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [2035]
OkouAu4173 ATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [196]
SclePe4347 ATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [1903]
StauCa4956 ATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [1777]
PilgMa4954 ATGGACAAGTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [1791]
PyruPu2737 ATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [2031]
BuckDi2735 ATGGACGACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAGG [2029]
ComaUm2738 ATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAG [2014]

[ 2060 2070 2080 2090 2100]
[ . . . . .]

AcanAs4051 GGCGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATT [2004]
AcanFa4053 GGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATTTATT [1889]
CervTo4273 GGCGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATT [2051]
JodiRh4052 GGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATT [2085]
OkouAu4173 GGCGATGCTACCACATCGAACCTGTTGCTGGAGAAGAAAATCAATATATT [246]
SclePe4347 GGCGATGCTACCACATCGAACCTGTTGCTGGAGAAGAAAATCAATATATT [1953]
StauCa4956 GGCGATGTTACCACATCGAACCTGTTGCTGGAGAAGAAAATCAATATATT [1827]
PilgMa4954 GGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATT [1841]
PyruPu2737 GGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATT [2081]
BuckDi2735 GCCGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATT [2079]
ComaUm2738 GACGATGCTACCACATCGAACCCGTTGCTGGAGAAGAAAATCAATATATT [2064]

[ 2110 2120 2130 2140 2150]
[ . . . . .]

AcanAs4051 GCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAA [2054]
AcanFa4053 GCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAA [1939]
CervTo4273 GCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAA [2101]
JodiRh4052 GCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAA [2135]
OkouAu4173 GCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAGGGTTCTGTTACTAA [296]
SclePe4347 GCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAA [2003]
StauCa4956 GCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAA [1877]
PilgMa4954 GCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAA [1891]
PyruPu2737 GCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAA [2131]
BuckDi2735 GCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTCGTATCAACAA [2129]
ComaUm2738 GCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAGGGTTCTGTTACTAA [2114]

[ 2160 2170 2180 2190 2200]
[ . . . . .]

AcanAs4051 CATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCTTGCGTG [2104]
AcanFa4053 CATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCTTGCGTG [1989]
CervTo4273 CATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCTTGCGTG [2151]
JodiRh4052 CATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCTTGCGTG [2185]
OkouAu4173 CATGTTTACTTCTATTGTGGGTAATGTATTCGGATTCAAAGCCTTGCGTG [346]
SclePe4347 CATGTTTACTTCTATTGTGGGTAATGTATTCGGATTCAAAGCCTTGCGTG [2053]
StauCa4956 CATGTTTACTTCTATTGTGGGTAATGTATTCGGATTCAAAGCCTTGCGTG [1927]
PilgMa4954 CATGTTTACTTCTATTGTGGGTAATGTATTCGGATTCAAAGCCTTGCGTG [1941]
PyruPu2737 CATGTTTACTTCTATTGTGGGTAATGTATTCCGGTTCAAAGCCTTGCGTG [2181]
BuckDi2735 CATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGTG [2179]
ComaUm2738 CATGTTTACTTCCATTGTGGGTAATGTCTTTGGGTTCAAAGCCCTGCGTG [2164]

[ 2210 2220 2230 2240 2250]
[ . . . . .]

AcanAs4051 CTCTACGGCTGGAGGATCTGCGAGTCCCTCCTGCTTATTCTAAAACTTTC [2154]
AcanFa4053 CTCTACGGCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTC [2039]
CervTo4273 CTCTACGGCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTC [2201]
JodiRh4052 CTCTACGGCTGGAGGATCTGCGAATACCCCCTGCTTATTCTAAAACTTTC [2235]
OkouAu4173 CTCTCCGGCTGGAGGATCTGCGAATCCCTACTTCTTATTCTAAAACTTTC [396]
SclePe4347 CTCTCCGGCTGGAGGATCTGCGAATCCCTACTGCTTATTCTAAAACTTTC [2103]
StauCa4956 CTCTCCGGCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTC [1977]
PilgMa4954 CTCTACGGCTGGAGGATCTGCGAGTCCCTCCTGCTTATTCTAAAACTTTC [1991]
PyruPu2737 CTCTACGGCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTC [2231]
BuckDi2735 CTCTACGGCTAGAGGATCTCCGAATCCCTCCTGCTTATTCTAAAACTTTC [2229]
ComaUm2738 CTCTCCGGTTGGAGGATCTGCGAATCCCTCCTGCTTATCTTAAAACTTTC [2214]

[ 2260 2270 2280 2290 2300]
[ . . . . .]

AcanAs4051 CAAGGCCCACCTCATGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2204]
AcanFa4053 CAAGGCCCACCTCATGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2089]
CervTo4273 CAAGGCCCACCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2251]
JodiRh4052 CAAGGCCCACCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2285]
OkouAu4173 CAAGGACCTCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA [446]
SclePe4347 CAAGGACCTCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2153]
StauCa4956 CAAGGACCTCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2027]
PilgMa4954 CAAGGGCCTCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2041]
PyruPu2737 CAAGGACCTCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2281]
BuckDi2735 CAAGGCCCCCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTA [2279]
ComaUm2738 CAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTA [2264]

[ 2310 2320 2330 2340 2350]
[ . . . . .]

AcanAs4051 TGGCCGACCCCTATTGGGATGTACTATTAAACCGAAATTGGGGTTATCCG [2254]
AcanFa4053 TGGCCGACCCCTATTGGGATGTACTATTAAACCGAAATTGGGGTTATCCG [2139]
CervTo4273 TGGCCGCCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCG [2301]
JodiRh4052 TGGACGACCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCG [2335]
OkouAu4173 CGGCCGTCCACTATTGGGATGTACTATTAAACCGAAATTGGGGTTATCCG [496]
SclePe4347 CGGCCGTCCACTATTGGGATGTACTATTAAACCGAAATTGGGGTTATCCG [2203]
StauCa4956 CGGCCGTCCACTATTGGGATGTACTATTAAACCGAAATTGGGGTTATCCG [2077]
PilgMa4954 CGGCCGTCCACTATTGGGATGTACTATTAAACCGAAATTGGGGTTATCCG [2091]
PyruPu2737 CGGCCGTCCACTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCG [2331]
BuckDi2735 TGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCG [2329]
ComaUm2738 TGGTCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCG [2314]

[ 2360 2370 2380 2390 2400]
[ . . . . .]

AcanAs4051 CCAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGAT [2304]
AcanFa4053 CCAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGAT [2189]
CervTo4273 CCAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGAT [2351]
JodiRh4052 CCAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGAT [2385]
OkouAu4173 CTAAGAACTACGGGAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGAT [546]
SclePe4347 CTAAGAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGAT [2253]
StauCa4956 CTAAGAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGAT [2127]
PilgMa4954 CTAAGAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGAT [2141]
PyruPu2737 CTAAGAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGAT [2381]
BuckDi2735 CTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGAT [2379]
ComaUm2738 CTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGCGGACTTGAT [2364]

[ 2410 2420 2430 2440 2450]
[ . . . . .]

AcanAs4051 TTTACCAAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGTTGGAG [2354]
AcanFa4053 TTTACCAAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGTTGGAG [2239]
CervTo4273 TTTACCAAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGTTGGAG [2401]
JodiRh4052 TTTACCAAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGTTGGAG [2435]
OkouAu4173 TTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAG [596]
SclePe4347 TTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAG [2303]
StauCa4956 TTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAG [2177]
PilgMa4954 TTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAG [2191]
PyruPu2737 TTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAG [2431]
BuckDi2735 TTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAG [2429]
ComaUm2738 TTTACCAAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAG [2414]

[ 2460 2470 2480 2490 2500]
[ . . . . .]

AcanAs4051 AGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAA [2404]
AcanFa4053 AGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAA [2289]
CervTo4273 AGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAA [2451]
JodiRh4052 AGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAA [2485]
OkouAu4173 AGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAA [646]
SclePe4347 AGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAA [2353]
StauCa4956 AGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAA [2227]
PilgMa4954 AGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAA [2241]
PyruPu2737 AGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAA [2481]
BuckDi2735 AGACCGTTTCTTATTTTGTGCCGAAGCCATTTATAAAGCACAGGCCGAAA [2479]
ComaUm2738 AGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAA [2464]

[ 2510 2520 2530 2540 2550]
[ . . . . .]

AcanAs4051 CGGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAA [2454]
AcanFa4053 CGGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAA [2339]
CervTo4273 CGGGCGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGTACATGCGAA [2501]
JodiRh4052 CAGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAA [2535]
OkouAu4173 CGGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGCGAA [696]
SclePe4347 CGGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGCGAA [2403]
StauCa4956 CGGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGCGAA [2277]
PilgMa4954 CGGGCGAAATCAAAGGCCATTACTTGAATGCTACTGCAGGTACATGCGAA [2291]
PyruPu2737 CGGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGCGAA [2531]
BuckDi2735 CAGGCGAAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACATGCGAA [2529]
ComaUm2738 CAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAA [2514]

[ 2560 2570 2580 2590 2600]
[ . . . . .]

AcanAs4051 GAAATGATGAAAAGGGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGT [2504]
AcanFa4053 GAAATGATCAAAAGGGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGT [2389]
CervTo4273 GAAATGATGAAAAGGGCTGTATGTGCTAGAGAATTGGGAGTTCCTATCGT [2551]
JodiRh4052 GAAATGATGAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGT [2585]
OkouAu4173 GAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCAT [746]
SclePe4347 GAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGT [2453]
StauCa4956 GAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCAT [2327]
PilgMa4954 GAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGT [2341]
PyruPu2737 GAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGT [2581]
BuckDi2735 GAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGT [2579]
ComaUm2738 GAAATGATCAAAAGGGCCGTATTTGCCAGAGAATTGGGAGTTCCTATCGT [2564]

[ 2610 2620 2630 2640 2650]
[ . . . . .]

AcanAs4051 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTC [2554]
AcanFa4053 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTC [2439]
CervTo4273 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTC [2601]
JodiRh4052 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTC [2635]
OkouAu4173 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCCC [796]
SclePe4347 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCCC [2503]
StauCa4956 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCCC [2377]
PilgMa4954 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTC [2391]
PyruPu2737 AATGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTC [2631]
BuckDi2735 AATGCATGACTACTTAACGGGGGGATTCACTGCAAATACTAGTTTGGCTC [2629]
ComaUm2738 AATGCATGACTACTTAACCGGAGGATTCACTGCAAATACTAGCTTGGCTC [2614]

[ 2660 2670 2680 2690 2700]
[ . . . . .]

AcanAs4051 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2604]
AcanFa4053 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2489]
CervTo4273 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCAT [2651]
JodiRh4052 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2685]
OkouAu4173 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [846]
SclePe4347 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2553]
StauCa4956 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2427]
PilgMa4954 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2441]
PyruPu2737 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2681]
BuckDi2735 ATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2679]
ComaUm2738 ATTATTGCCGAGATAACGGCCTACTTCTTCACATCCATCGTGCAATGCAT [2664]

[ 2710 2720 2730 2740 2750]
[ . . . . .]

AcanAs4051 GCGGTTATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGC [2654]
AcanFa4053 GCGGTTATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGC [2539]
CervTo4273 GCGGTTATTGATAGACAAAAGAATCATGGTATACACTTTCGTGTACTAGC [2701]
JodiRh4052 GCGGTTATTGATAGACAAAAGAATCATGGTATAGAGTTTCGTGTACTAGC [2735]
OkouAu4173 GCGGTTATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGC [896]
SclePe4347 GCGGTTATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGC [2603]
StauCa4956 GCGGTTATTGATAGACAAAAGAATCATGGTATACACTTTCGTGTACTAGC [2477]
PilgMa4954 GCGGTTATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGC [2491]
PyruPu2737 GCGGTTATTGATAGACAAAAGAATCATGGTATACACTTTCGTGTACTAGC [2731]
BuckDi2735 GCGGTTATTGATAGACAAAAGAATCATGGTATACACTTTCGTGTATTAGC [2729]
ComaUm2738 GCGGTTATTGATAGACAAAAGAATCATGGTATACACTTCCGTGTACTAGC [2714]

[ 2760 2770 2780 2790 2800]
[ . . . . .]

AcanAs4051 TAAAGCTTTACGTATGTCTGGGGGAGATCATATTCACGCTGGTACTGTAG [2704]
AcanFa4053 TAAAGCTTTACGTATGTCTGGGGGAGATCATATTCACGCTGGTACTGTAG [2589]
CervTo4273 TAAAGCTTTACGTATGTCTGGGGGAGATCATATTCACGCTGGTACTGTAG [2751]
JodiRh4052 TAAAGCTTTACGTATGTCTGGGGGAGATCATATTCACGCGGGTACTGTAG [2785]
OkouAu4173 TAAAGCTTTACGTCTGTCTGGTGGAGATCATATTCACGCGGGTACTGTAG [946]
SclePe4347 TAAAGCTTTACGTCTGTCTGGTGGAGATCATATTCACGCGGGTACTGTAG [2653]
StauCa4956 TAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCGGGTACTGTAG [2527]
PilgMa4954 TAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCGGGTACTGTAG [2541]
PyruPu2737 TAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCGGGTACTGTAG [2781]
BuckDi2735 TAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTCG [2779]
ComaUm2738 TAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAG [2764]

[ 2810 2820 2830 2840 2850]
[ . . . . .]

AcanAs4051 TAGTTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [2754]
AcanFa4053 TAGGTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [2639]
CervTo4273 TAGGTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [2801]
JodiRh4052 TAGGTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [2835]
OkouAu4173 TAGGTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [996]
SclePe4347 TAGGTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [2703]
StauCa4956 TAGGTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [2577]
PilgMa4954 TAGGTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [2591]
PyruPu2737 TAGGTAAACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTA [2831]
BuckDi2735 TAGGTAAACTTGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTA [2829]
ComaUm2738 TAGGTAAACTTGAGGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTA [2814]

[ 2860 2870 2880 2890 2900]
[ . . . . .]

AcanAs4051 CTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [2804]
AcanFa4053 CTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [2689]
CervTo4273 CTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [2851]
JodiRh4052 CTACGCGATGATTTTGTTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [2885]
OkouAu4173 CTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [1046]
SclePe4347 CTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [2753]
StauCa4956 CTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [2627]
PilgMa4954 CTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [2641]
PyruPu2737 CTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCAC [2881]
BuckDi2735 CTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTAC [2879]
ComaUm2738 CTACGTGATGATTTTGTTGAAAAAGACCGAAGTCGTGGTATTTATTTTAC [2864]

[ 2910 2920 2930 2940 2950]
[ . . . . .]

AcanAs4051 TCAAGATTGGGTCTCGCTACCCGGCGTTTTGCCCGTAGCTTCNGGGGGTA [2854]
AcanFa4053 TCAAGATTGGGTCTCGCTACCCGGCGTTTTGCCCGTAGCTTCGGGGGGTA [2739]
CervTo4273 TCAAGATTGGGTCTCGCTACCCGGCGTTTTGCCCGTAGCTTCGGGGGGTA [2901]
JodiRh4052 TCAAGATTGGGTCTCGCTACCCGGCGTTTTGCCCGTAGCTTCGGGGGGTA [2935]
OkouAu4173 TCAGGATTGGGTCTCACTACCAGGCGTTTTACCCGTAGCTTCAGGGGGTA [1096]
SclePe4347 TCAGGATTGGGTCTCACTACCAGGCGTTTTACCCGTAGCTTCAGGGGGTA [2803]
StauCa4956 TCAGGATTGGGTCTCACTACCAGGCGTTTTACCCGTAGCTTCGGGGGGTA [2677]
PilgMa4954 TCAGGATTGGGTCTCACTACCAGGCGTTTTACCCGTAGCTTCGGGGGGTA [2691]
PyruPu2737 TCAGGATTGGGTCTCACTACCAGGCGTTTTACCCGTAGCTTCGGGGGGTA [2931]
BuckDi2735 TCAAGATTGGGTCTCGCTACCAGGCGTTTTACCCGTAGCTTCGGGGGGTA [2929]
ComaUm2738 TCAAGATTGGGTCTCGCTACCAGGCGTTTTGCCTGTAGCTTCGGGGGGTA [2914]

[ 2960 2970 2980 2990 3000]
[ . . . . .]

AcanAs4051 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCC [2904]
AcanFa4053 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCC [2789]
CervTo4273 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCC [2951]
JodiRh4052 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCC [2985]
OkouAu4173 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCC [1146]
SclePe4347 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCC [2853]
StauCa4956 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCC [2727]
PilgMa4954 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCC [2741]
PyruPu2737 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATTTTTGGGGATGATTCC [2981]
BuckDi2735 TTCATGTTTGGCATATGCCTGCTCTGACCGATATCTTTGGGGATGATTCT [2979]
ComaUm2738 TTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCT [2964]

[ 3010 3020 3030 3040 3050]
[ . . . . .]

AcanAs4051 GTACTACAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [2954]
AcanFa4053 GTACTACAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [2839]
CervTo4273 GTACTACAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [3001]
JodiRh4052 GTACTACAGTTCGGTGGAGGAACCCTAGGACACCCTTGGGGAAATGCACC [3035]
OkouAu4173 GTACTACAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [1196]
SclePe4347 GTACTACAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [2903]
StauCa4956 GTACTACAGTTCGGTGGAGGANCCTTAGGACACCCTTGGGGAAATGCACC [2777]
PilgMa4954 GTACTACAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [2791]
PyruPu2737 GTACTACAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [3031]
BuckDi2735 GTATTACAATTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [3029]
ComaUm2738 GTACTACAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACC [3014]

[ 3060 3070 3080 3090 3100]
[ . . . . .]

AcanAs4051 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTA [3004]
AcanFa4053 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTA [2889]
CervTo4273 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTA [3051]
JodiRh4052 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTA [3085]
OkouAu4173 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTA [1246]
SclePe4347 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTA [2953]
StauCa4956 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTA [2827]
PilgMa4954 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTA [2841]
PyruPu2737 GGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCCCGTA [3081]
BuckDi2735 GGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTA [3079]
ComaUm2738 GGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGCA [3064]

[ 3110 3120 3130 3140 3150]
[ . . . . .]

AcanAs4051 ATGAGGGACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [3054]
AcanFa4053 ATGAGGGACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [2939]
CervTo4273 ATGAGGGACGTGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [3101]
JodiRh4052 ATGAGGGACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [3135]
OkouAu4173 ATGAGGGACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [1296]
SclePe4347 ATGAGGGACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [3003]
StauCa4956 ATGAGGGACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [2877]
PilgMa4954 ATGAGGGGCGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [2891]
PyruPu2737 ATGAGGGACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCT [3131]
BuckDi2735 ATGAGGGACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCT [3129]
ComaUm2738 ATGAGGGACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCT [3114]

[ 3160 3170 3180 3190 3200]
[ . . . . .]

AcanAs4051 AGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGAT [3104]
AcanFa4053 AGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGAT [2989]
CervTo4273 AGCAAATGGAGTCCTGAACTAGCTACTGCATGTGAAGTATGGAAGGAGAT [3151]
JodiRh4052 AGCAAATGGAGTCCCGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGAT [3185]
OkouAu4173 AGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGAT [1346]
SclePe4347 AGCAAA-------------------------------------------- [3009]
StauCa4956 ANCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGAT [2927]
PilgMa4954 AGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGAT [2941]
PyruPu2737 AGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGAT [3181]
BuckDi2735 AGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGAT [3179]
ComaUm2738 AGCAAATGGAGTGCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGAT [3164]

[ 3210 3220 3230 3240 3250]
[ . . . . .]

AcanAs4051 CAAATTTGAATTCCAAGCAATGGACACTTTGTAACAGGAGTATATTTATG [3154]
AcanFa4053 CAAATTTGAATTCCAAGCAATGGACACTTTGTAA---------------- [3023]
CervTo4273 CAAATTTGAATTCCAAGCAATGGACACTTTGTAA---------------- [3185]
JodiRh4052 CAAATTTGAATTCCAAGCAATGGACACTTTGTAA---------------- [3219]
OkouAu4173 CAAATTTGAATTCCAAGCAGTGGATMCTTTGTAA---------------- [1380]
SclePe4347 -------------------------------------------------- [3009]
StauCa4956 AAAATTTGAATTCCAAGCAATGGATACTTTGTAA---------------- [2961]
PilgMa4954 CAAATTTGAATTCCAAGCAATGGATACTTTGTAA---------------- [2975]
PyruPu2737 CAAATTTGAATTCCAAGCAATGGATACTTTGTAA---------------- [3215]
BuckDi2735 CAAATTTGAATTCCAAGCAATGGATACTTTGTAACAGGAGTATATTTATG [3229]
ComaUm2738 AAAATTTATATTCCCAGCAATGGATACTTTGTAA---------------- [3198]

[ 3260 3270 3280 3290 3300]
[ . . . . .]

AcanAs4051 CACTTACTTACGATCGTAGTTTAACTAGATCAATTATCTTAGAAAATTTA [3204]
AcanFa4053 -----------------AGTTTAACTAGATCAATTATCTTAGAAAATTTA [3056]
CervTo4273 -------------------------------------------------- [3185]
JodiRh4052 -------------------------------------------------- [3219]
OkouAu4173 -------------------------------------------------- [1380]
SclePe4347 -------------------------------------------------- [3009]
StauCa4956 -------------------TTTAACTAGATCAATTATCTTAGAAAATGTA [2992]
PilgMa4954 -------------------TTTAACTAGATCAATTATCTTAGAAAATGTA [3006]
PyruPu2737 ----------------CAGTTTAACTAGATCAATTATCTTAGAAAATGTA [3249]
BuckDi2735 CACTTACTCACGATCGTGGTTTAACTAGTTCCATTATGTTAGAAAATGTA [3279]
ComaUm2738 --------------------------------------TTAGAAAATGTG [3210]

[ 3310 3320 3330 3340 3350]
[ . . . . .]

AcanAs4051 GATTCTGACAATAAATTCAGTTTACTAATTGCGAAACGTTTAATTATTCG [3254]
AcanFa4053 GATTATGACAATAAATTCAGTTTACTAATTGCGAAACGTTTAATTATTCG [3106]
CervTo4273 --TTATGACAATAAATTCAGTTTACTAATTGCGAAACGTTTAATTATTCG [3233]
JodiRh4052 -GTTATGACAATAAATTCAGTTTACTAATTGCGAAACGTTTAATTATTCG [3268]
OkouAu4173 -ATTATGACAATAAGTTCAGTTTATTAATTGCGAAACGTTTAATTATTCG [1429]
SclePe4347 -------------------GTTTATTAATTGCGAAACGTTTAATTATTCG [3040]
StauCa4956 GATTATGACAATAAGTTCAGTTTATTAATTGCGAAACGTTTAATTATTCG [3042]
PilgMa4954 GATTATGACAATAAGTTCAGTTTACTAATTTCTAAACGTTTAATTATTCG [3056]
PyruPu2737 AATTATGACAATAAGTTCAGTTTACTAATTGCGAAACGTTTAATTATTCG [3299]
BuckDi2735 AATTATGACAAAAAATTTAGTTTACTAATTGTGAAACGTTTAACTACTCA [3329]
ComaUm2738 GGTTATGAAAAAAAATTCAGTTTACTAATTGTCAAACGTTTAATTACTCG [3260]

[ 3360 3370 3380 3390 3400]
[ . . . . .]

AcanAs4051 AATGTATCAACAGAATCATTTGCTTATTTTCACTAATGATTCTAACCAAA [3304]
AcanFa4053 AATGTATCAACAGAATCATTTGCTTATTTTCACTAATGATTCTAACCAAA [3156]
CervTo4273 AATGTATCAACAGAATCATTTGCTTATTTTCACTAATGATTCTAACCAAA [3283]
JodiRh4052 AATGTATCAACAGAATCATTTGCTTATTTTCACTAATGATTCTAACCAAA [3318]
OkouAu4173 AATGTATCAACAGAATCATTTGCTTATTTCCACTAATGATTCTAACCAAA [1479]
SclePe4347 AATGTATCAACAGAATCATTTGCTTATTTCCACTAATGATTCTAACCAAA [3090]
StauCa4956 AATGTATCAACAGAATCATTTGCTTATTTCCACTAATGATTCTAACCAAA [3092]
PilgMa4954 AATGTATCAACAGAATCATTTGCTTATTTCCACTAATGATTCTAACCAAA [3106]
PyruPu2737 AATGTATCAACAGAATTATTTGCTTATTTCCACTAATGATTCTAACCAAA [3349]
BuckDi2735 AATGTACCAACAGAACCGTTTGCTTATTTCCGCTAATGATTCTAACCAAA [3379]
ComaUm2738 AATGTATCAACAAAATCGTTTTATTATTTCCGCTAATGATTCTAATCCAA [3310]

[ 3410 3420 3430 3440 3450]
[ . . . . .]

AcanAs4051 ATATATTTTTTGGGCATAACAAAAATGTGTATTTTCGAATGATACCGGAG [3354]
AcanFa4053 ATATATTTTTTGGGCATAACAAAAATGTGTATTTTCGAATGATACCGGAG [3206]
CervTo4273 ATATATTTTTTGGGCATAACAAAAATGTGTATTTTCGAATGATACCGGAG [3333]
JodiRh4052 ATATATTTTTTGGGCATAACAAAAATGTGTATTTTCGAATGATACCGGAG [3368]
OkouAu4173 ATCCATTTTTCGGGCATAACAAAAATGTGTATTTTCGACTGATACCGGAG [1529]
SclePe4347 ATCCGTTTTTCGGGCATAACAAAAATGTGTATTTTCGACTGATACCGGAG [3140]
StauCa4956 ATACATTTTTCGGGCATAACAAAAATGTGTATTTTCGACTGATACCGGAG [3142]
PilgMa4954 ATCCATTTTTCGGGCATAACAAAAATGTGTATTTTCGACTGATACCGGAG [3156]
PyruPu2737 ATCCATTTTTCGGGCATAACAAAAATGTGTATTTTCGACTGATACCGGAG [3399]
BuckDi2735 ATATATTTTTCGGACATAACAAAAATTTTTATTTTCAAATGATATCAGAT [3429]
ComaUm2738 ATCTATTTTTGGGGCATAATAAAGATTTTGATTTGCAAATGATACCAGAG [3360]

[ 3460 3470 3480 3490 3500]
[ . . . . .]

AcanAs4051 GGGTTTGCAGTCATTGTGGAAATTCCATTTTCCCTACGCTTAGTATCTTC [3404]
AcanFa4053 GGGTTTGCAGTCATTGTGGAAATTCCATTTTCCCTACGCTTAGTATCTTC [3256]
CervTo4273 GGGTTTGCAGTCATTGTGGAAATTCCATTTTCCCTACGCTTAGTATCTTC [3383]
JodiRh4052 GGGTTTGCAGTCATTGTGGAAATTCCATTTTCCCTACGCTTAGTATCTTC [3418]
OkouAu4173 GGATTTGCAATAATTGTGGAAATTCCATTTTCCCTACGCTTAGTATCCTC [1579]
SclePe4347 GGATTTGCAGTAATTGTGGAAATTCCATTTTCCCTACGCTTAGTATCTTC [3190]
StauCa4956 GGATTTGCAATAATTGTAGAAATTCCATTTTCCCTACGCTTAGTATCTTC [3192]
PilgMa4954 GGATTTGCAATAATTGTGGAAATTCCATTTTCCCTACGCTTAGTATCTTC [3206]
PyruPu2737 GGATTTGCAATAATTGTGGAAATTCCATTTTCCCTACGCTTAGTATCTTC [3449]
BuckDi2735 GGATTTGCAGTCATTGTGGAAATTCCTTTTTCCCTGCGCTTAATGGCTTC [3479]
ComaUm2738 GGATTTACAGTCATTGTGGAAATTCCATTTTCCCTACGATTAGTATCTTC [3410]

[ 3510 3520 3530 3540 3550]
[ . . . . .]

AcanAs4051 TCTAGAAGCTAAAAAAATGGAAGAATATCAGAATTTACGATCAATTCATT [3454]
AcanFa4053 TCTAGAAGCTAAAAAAATGGAAGAATATCAGAATTTACGATCAATTCATT [3306]
CervTo4273 TCTAGAAGCTAAAAAAATGGAAGAATATCAGAATTTACGATCAATTCATT [3433]
JodiRh4052 TCTAGAAGCTAAAAAAATGGAAGAATATCAGAATTTACGATCAATTCATT [3468]
OkouAu4173 TCTAGAAGCTAAAAAAATAGAAGAATCTCATAATTTACGATCAATTCATT [1629]
SclePe4347 TCTAGAAGCTAAAAAAATAGAAGAATCTCATAATTTACGATCAATTCATT [3240]
StauCa4956 TCTAGAAGCTAAAAAAATAGAAGAATCTCATAATTTACGATCAATTCATT [3242]
PilgMa4954 TCTAGAAGCTAAAAAAATAGAAGAATCTCGTAATTTACGATCAATTCATT [3256]
PyruPu2737 TCTAGAAGCGAAAAAAATAGAAGAATCTCATAATTTACGATCAATTCATT [3499]
BuckDi2735 TATAGAAGCGAAAAAAATTAGAAGATCTCATAATTTACGATCAATTCATT [3529]
ComaUm2738 TCTAGAAGCGAAAAAAATAGAAGAATTTAAGAATTTAGGATCAATTCATT [3460]

[ 3560 3570 3580 3590 3600]
[ . . . . .]

AcanAs4051 CAATATTTCCTTTTTTAGAGGACAAATTCCCACATTTAAATTATGTATCA [3504]
AcanFa4053 CAATATTTCCTTTTTTAGAGGACAAATTCCCACATTTAAATTATGTATCA [3356]
CervTo4273 CAATATTTCCTTTTTTAGAGGACAAATTCACACATTTAAATTATGTATCA [3483]
JodiRh4052 CAATATTTCCTTTTTTAGAGGACAAATTCCCACATTTAAATTATGTATCA [3518]
OkouAu4173 CAATATTTCCTTTTTTAGAGGACAAATTCCCCCATTTAAATTATGTATCA [1679]
SclePe4347 CAATATTTCCTTTTTTAGAGGACAAATTCCCCCATTTAAATTATGTATCA [3290]
StauCa4956 CAATATTTCCTTTTTTAGAGGACAAATTCCCCCATTTAAATTATGTATCA [3292]
PilgMa4954 CAATATTTCCTTTTTTAGAGGACAAATTCCCCCATTTAAATTATCTATCA [3306]
PyruPu2737 CAATATTTCCTTTTTTAGAGGACAAATTCCCCCATTTAAATTATGTATCA [3549]
BuckDi2735 CAATATTTCCTTTTTTAGAGGACAAATTCCCCTATTTAAATTTTGTGTCA [3579]
ComaUm2738 CAATATTTCCTTTTTTAGAGGATAAATTTCCCCATTTAAATTATGTGTCA [3510]

[ 3610 3620 3630 3640 3650]
[ . . . . .]

AcanAs4051 AATATACTAATACCTTATCCTGTCCATCTGGAAATCTTGGTTCAAATTCT [3554]
AcanFa4053 AATATACTAATACCTTATCCTGTCCATCTGGAAATCTTGGTTCAAATTCT [3406]
CervTo4273 AATATACTAATACCCTATCCTGTCCATCTGGAAATCTTGGTTCAAATTCT [3533]
JodiRh4052 AATATACTAATACCTTATCCTGTCCATCTGGAAATCTTGGTTCAAATTCT [3568]
OkouAu4173 AATATACTAATACCCTATCCTGTCCATCTGGAAATTTTGGTTCAAATTAT [1729]
SclePe4347 AATATACTAATACCCTATCCTGTCCATCTGGAAATTTTGGTTCAAATTAT [3340]
StauCa4956 AATATACTAATACCCTATCCTGTCCATCTGGAAATTTTGGTTCAAATTAT [3342]
PilgMa4954 AATATACTAATACCCTATCCTGTCCATCTGGAAATTTTGGTTCAAATTAT [3356]
PyruPu2737 AATATACTAATACCCTATCCTGTCCATCTGGAAATCTTGGTTCAAATTAT [3599]
BuckDi2735 AATATATTAATACCTTATCCTGTCCATCTGGAAATCTTGGTTCAAATTCT [3629]
ComaUm2738 AATCTATTAATACCCTACCCTGTCCATCTGGAAATCTTGGTTCAAACTCT [3560]

[ 3660 3670 3680 3690 3700]
[ . . . . .]

AcanAs4051 TCGTTACTGGGTAAAAGATGCCTCATTTTTGCATTTTTTACGATTCTTTT [3604]
AcanFa4053 TCGTTACTGGGTAAAAGATGCCTCATTTTTGCATTTTTTACGATTCTTTT [3456]
CervTo4273 TCGTTACTGGGTAAAAGATGCCTCATTTTTGCATTTTTTACGATTATTTT [3583]
JodiRh4052 TCGTTACTGGGTAAAAGATGCTTCATTTTTGCATTTTTTACGATTCTTTT [3618]
OkouAu4173 CCGTTACTGGGTAAAAGATGCCTCGTTTTTGCATTTTTTACGATTCTTTT [1779]
SclePe4347 CCGTTACTGGGTAAAAGATGCCTCGTTTTTGCATTTTTTACGATTCTTTT [3390]
StauCa4956 CCGTTACTGGGTAAAAGATGCCTCGTTTTTGCATTTTTTACGATTCTTTT [3392]
PilgMa4954 CCGTTACTGGGTAAAAGATGCCTCGTTTTTGCATTTTTTACGAGTCTTTT [3406]
PyruPu2737 CCGTTACTGGGTAAAAGATGCCGCGTTTTTGCATTTTTTACGATGCTTTT [3649]
BuckDi2735 TCGTTACTGGGTGAAAGATGCCTCTTCTTTGCATTTTTTACGATTCTTTT [3679]
ComaUm2738 TCGTTACTGGGTGAAAGATGCCTCTTCTTTGCATTTTTTACGATTCTTTT [3610]

[ 3710 3720 3730 3740 3750]
[ . . . . .]

AcanAs4051 TCCACGAGAATCATAATTTGAATAGTTTGATTTCTCCAAATAAATCCATT [3654]
AcanFa4053 TCCACGAGAATCATAATTTGAATAGTTTTATTTCTCCAAATAAATCCATT [3506]
CervTo4273 TCCACGAGACTCATAATTTGAATAGTTTTATTTCTCCAAATAAATCCATT [3633]
JodiRh4052 TCCACGAGAATCATAATTTGAATAGTTTTATTTCTCCAAATAAATCCATT [3668]
OkouAu4173 TCCACGAGAATCATAATTGGAATGGTTTTCTTTCTCCAAAAAAATCCATT [1829]
SclePe4347 TCCACGAGAATCATAATTGGAATGGTTTTATTTATCCAAAAAGATCCATT [3440]
StauCa4956 TCCACGAGAATCATAATTGGAATGGTTTTATTTCTCCAAAAAAATACATT [3442]
PilgMa4954 TCCACGAGAATCATAATTGGAATGGTTTTATTTCTCCAAAAAAATCCATT [3456]
PyruPu2737 TCCACGAGAATCATAATTGGAATGGGTTTCTTTCTCCAAAAAAATCCATT [3699]
BuckDi2735 TCCACGAGAATCATAATTGGAATAGTTGGATTTCTCCAAAGAAATCCATT [3729]
ComaUm2738 TCCACGAGAATCCTAATTGTAATAATGTTATTTCTTCAAAAAAAACCACT [3660]

[ 3760 3770 3780 3790 3800]
[ . . . . .]

AcanAs4051 TCCACCCTTTCA------------AAAAGAAATCAAAGGCTGCTTCTGTT [3692]
AcanFa4053 TCCACCCTTTCA------------AAAAGAAATCAAAGGCTGCTTCTGTT [3544]
CervTo4273 TCCACCCTTTCA------------AAAAGAAAGCAAAGGCTGCTTCTGTT [3671]
JodiRh4052 TACACCCTTTCA------------AAAAGAAATCAAAGGCTGCTTCTGTT [3706]
OkouAu4173 TCCACCCTTTCA------------AAAAGAAATAAAAGGCTGTCTCTGTT [1867]
SclePe4347 TCCACCCTTTCA------------AAAAGAAATAAAAGGCTGTCTCTGTT [3478]
StauCa4956 TCCACCCTTTCA------------AAAAGAAATAAAAGGCTGTCTCTGTT [3480]
PilgMa4954 TCCACCCTTTCA------------AAAAGAAATAAAAGGCTGCCTCTGTT [3494]
PyruPu2737 TCCACCCTTTCA------------AAAAGAAATAAAAGGCTGCTTCTGTT [3737]
BuckDi2735 TCCATCCTTTCACTTTCACATCNAAAAAGAAATCCCAGAATTTTATTGGT [3779]
ComaUm2738 GCTATCGTTTCA------------AAAAGAAATCCAAGAATGGTCTTGGT [3698]

[ 3810 3820 3830 3840 3850]
[ . . . . .]

AcanAs4051 CCTATATAATTCTCAGGTCTGTGAATACGAATCGGTTTTTCGTTTTCTCC [3742]
AcanFa4053 CCTATATAATTCTCATGTCTGTGAATACGAATCGGTTTTCGTTTTTCTGC [3594]
CervTo4273 CCTATATAATTCTCATGTCTGTGAATACGAATCGGTTTTCGTTTTTCTCC [3721]
JodiRh4052 CCTATATAATTCTCATGTCTGTGAATACGAATCGGTTTTTATTTTTCTCC [3756]
OkouAu4173 CCTATATAATTCTCATGTCTGTGAATACGAATCGGTTTTAGTTTTTCTCC [1917]
SclePe4347 CCTATATAATTCTCATGTCTGGGAATACGAATCGGTTTTTAGTTTTCTCC [3528]
StauCa4956 CCTATATAATTCTCATGTCTGTGAATACGAATCGGTTTTAGTTTTTCTCC [3530]
PilgMa4954 CCTATATAATTCTCATGTCTGTGAATACGAATCGGTTTTAGTTTTTCTCC [3544]
PyruPu2737 CCTATATAATTCTCATGTCTGTGAATACGAATCGGTTTTTGTTTTTCTCC [3787]
BuckDi2735 CCTATATAATTCTCATGGCTGTGAATACGAATCCATTTTCATTTTTCTCC [3829]
ComaUm2738 CCTATATAATTCTTATATCTGTGAATATGAATCTGGTTTCATTTTTCTTC [3748]

[ 3860 3870 3880 3890 3900]
[ . . . . .]

AcanAs4051 GTAACAAATCTTCTCATTTACGATCACCATCTTTTGGGACCCTTCTTGAG [3792]
AcanFa4053 GTAACAAATCTTCTCATTTACGATCAACATCTTTTGGGACCCTTCTTGAG [3644]
CervTo4273 GTAACAAATCTTCTCATTTACGATCAACATCTTTTGGGACCCTTCTTGAG [3771]
JodiRh4052 GTAACAAATCTTCTCATTTACGATCAACATCTTTTGGGACCCTTCTTGAA [3806]
OkouAu4173 GTAACAAATCTTCTCATTTACGATCAACATCTTTTGGGACCCTTCTTGAG [1967]
SclePe4347 GTAACAAATTTTCTCATTTACGATCAACATCTTTTGGGACCCTTCTTGAC [3578]
StauCa4956 GTAACAAATCTTCTCATTTACGATCAACATCTTTTGGGACCCTTCTTGAG [3580]
PilgMa4954 GTAACAAATCTTCTCATTTACGATCAACATCTTTTGGGACCCTTCTTGAG [3594]
PyruPu2737 GTAACAAATCTTCTCATTTACGATCAACATCTTTTGGGACCCTTCTTGAG [3837]
BuckDi2735 GTAACCAATCCTCTTATTTACGATCAACATCTTTTGGAACCCCTCTTGAG [3879]
ComaUm2738 GGAACCAATCTTATCATTTACGATCAACATCATTTGGAGCTCTTTTTGAA [3798]

[ 3910 3920 3930 3940 3950]
[ . . . . .]

AcanAs4051 CGAATATATTTCTATGGAAAAATAGAACATTTATTGGATGTCTTTACTAA [3842]
AcanFa4053 CGAATATATTTCTATGGAAAAATAGAACATTTATTGGATGTCTTTACTAA [3694]
CervTo4273 CGAATATATTTCTATGGAAAAATAGAACATTTATTGGATGTCTTTACTAA [3821]
JodiRh4052 CGAATATATTTATATGTAAAAATAGAACATTTATTGGATGTCTTTACTAA [3856]
OkouAu4173 CGAATATATTTCTATGGAAAAATAGAACATTTGTTCTATGTCTTTAATAA [2017]
SclePe4347 CGAATATATTTCTATGGAAAAATAGAACATTTGTTGTATGTCTTTAATAA [3628]
StauCa4956 CGAATATATTTCTATGGAAAAATAGAACATTTGTTGTATGTCTTTAATAA [3630]
PilgMa4954 CGAATATATTTCTATGGAAAAATAGAACATTTGGTGTATATCTTTAATAA [3644]
PyruPu2737 CGAATATATTTCTATGGAAAAATAGAACATTTGTTGTATGTCTTTAATAA [3887]
BuckDi2735 CGAATCTATTTCTACGGAAAAATAGAATATTTCATGGGTGTCTTTACTAA [3929]
ComaUm2738 CGACTATATTTCTATGGAAAAATAGACTATCTCGGGGATATCATTACTAA [3848]

[ 3960 3970 3980 3990 4000]
[ . . . . .]

AcanAs4051 GGATTTTCAGACTATTCCATGGTCGTTCAAGGATCCCTTCATGCATTATG [3892]
AcanFa4053 GGATTTTCAGACTATTCCATGGTTGTTCAAGGATCCCTTCATGCATTATG [3744]
CervTo4273 GGATTTTCAGACTATTCCATGGTTGTTCAAGGATCCCTTCATGCATTATG [3871]
JodiRh4052 GGATTTTCAGACTATTCCATGGTTGTTCAAGGATTCCTTCATGCATTATG [3906]
OkouAu4173 GGATTTTCAAATTATTCCATGGGTGTTCAAGGATCTCTTAATGCATTATG [2067]
SclePe4347 GGATTTTAAAATTCTTCCATGGTTGTTCAAGGATCCCTTAATGCATTATG [3678]
StauCa4956 GGGTTTTCAAATTATTCCATGGTTGTTCAAGGATCCCTTAATGCATTATG [3680]
PilgMa4954 GGATTTTCAGACTATTCCATGGGTGTTCAAGGATCCCTTAATGCATTATG [3694]
PyruPu2737 GGATTTTCAGACTATTCCATGGTTGTTCAAGGATCCCTTAATGCATTATG [3937]
BuckDi2735 AGATTTTCAGGCTATTCCATGGTTGTTCAAGGATCCTTTCATGCATTATG [3979]
ComaUm2738 AGATGGTAAGGCCATTCCATGGTGGTTTAAGGACCTTTTCGTGCATTATG [3898]

[ 4010 4020 4030 4040 4050]
[ . . . . .]

AcanAs4051 TTAGGTATCAAGGAAAATTCATTCTGGCTTCAAAAGGGACGCCTCTTCTG [3942]
AcanFa4053 TTAGGTATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACGCCTCTTCTG [3794]
CervTo4273 TTAGGTATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACGCCTCTTCTG [3921]
JodiRh4052 TTAGGTATCAAGGAAAATTTATTCTGGCTTCAAAAGGGACGCCTCTTCTG [3956]
OkouAu4173 TTAGGTATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACGTCTCTTCTA [2117]
SclePe4347 TTAGGTATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACGTCTCTTTTA [3728]
StauCa4956 TTAGGTATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACGTCTCTTCTA [3730]
PilgMa4954 TTAGGTATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACGGCTCTTCTA [3744]
PyruPu2737 TTAGGTATCAAGGAAAATTAATTCTGGCTTCAAAAGGGACGTCTCTTCTA [3987]
BuckDi2735 TTAGGTATCAAGGAAAATCCATTCTAGCTTCAAAAGGGATGCCTCTTCTG [4029]
ComaUm2738 TTAGGTATCAAGGCAAATCAATTCTGGCTTTAAAAGGGACGCCTCTTCTG [3948]

[ 4060 4070 4080 4090 4100]
[ . . . . .]

AcanAs4051 ATGAATAAATGGAAATATTACCTTTCCCATTTTTGTCAATGTCGTTTTTA [3992]
AcanFa4053 ATGAATAAATGGAAATATTACCTTTCCCATTTTTGTCAATGTCGTTTTTA [3844]
CervTo4273 ATGAATAAATGGAAATATTACCTTTCCCATTTTTGGCAATGTCGTTTTTA [3971]
JodiRh4052 ATGAATAAATGGAAATATTACCTTTCCCATTTTTGGCAATGTCGTTTTTA [4006]
OkouAu4173 ATGAATAAATGGAAATATTACCTTGCTCATTTCTGGCAATGTCGTTTTTA [2167]
SclePe4347 ATGAATAAATGGAAATCTTACCTTGCTCATTTCTGGCAATGTCGTTTTTA [3778]
StauCa4956 ATGAATAAATGGAAATATTACCTTGCTCATTTCTGGCAATGTCGTTTTTA [3780]
PilgMa4954 ATGAATAAATGGAAATATTACCTTGCGCATTTCTGGCAATATCGTTTTTA [3794]
PyruPu2737 ATGAATAAATGGAAATATTACCTTGCTCATTTCTGGCAATGTCGTTTTTA [4037]
BuckDi2735 ATGAATAAATGGAAATATTACCTTGTCCATTTTTGGCAATATCGTTTTTA [4079]
ComaUm2738 ATGAATAAATGGACAAATTACCTTATCCATTTTTGGCAATGTCATTTTTA [3998]

[ 4110 4120 4130 4140 4150]
[ . . . . .]

AcanAs4051 TATGTGGTCTCAACCGGGAAGGATACGTATAAACCAATTAAGC---AATC [4039]
AcanFa4053 TATGTGGTCTCAACCGGGAAGGATCCGTATAAACCAATTAAGC---AATC [3891]
CervTo4273 TACGTGGTCTCAACCAGGAAGGATCCGTATAAACCAATTACGC---AATC [4018]
JodiRh4052 TATGTGGTCTAAACCAGGAAGTATCCGTATAAACCAATTACGC---AATC [4053]
OkouAu4173 TATGTGGTTTCAACCAGTAAGGATACATATAAACCAATTATGC---AATC [2214]
SclePe4347 TATGTGGTTTCAACCAGTAAGGATACATATAAACCAATTATGC---AATC [3825]
StauCa4956 TATGTGGTTTCAACCAGTAAGGATACATATAAACCCATTATGC---AATC [3827]
PilgMa4954 TATGTGGTCTCAACCAGTAAGGATACATATAAACCAATTATGC---AATC [3841]
PyruPu2737 TATGTGGTCTCAACCAGTAAGGATATATATAAACCAATTATGC---AATC [4084]
BuckDi2735 TGTGTGGTTTCAACCAGGAAGGATTCATATAAATCAATTATCC---AATC [4126]
ComaUm2738 TGTGTGGTCTCACCCAGGAAGGATTCATATAAACCAAGTATCCACCAATC [4048]

[ 4160 4170 4180 4190 4200]
[ . . . . .]

AcanAs4051 ATTCCTTCAACTTTCTAGGTTATCTTTCAAGTGTACGATTAAATCCTTCC [4089]
AcanFa4053 ATTCCTTCAACTTTCTAGGTTATCTTTCAAGTGTACGATTAAATCCTTCC [3941]
CervTo4273 ATTCCTTCAGCTTTCTAGGTTATTTTTCAAGTGTCCGATTAAATCCTTCC [4068]
JodiRh4052 ATTCCTTCAACTTTCTAGGTTATCTTTCAAGTGTACGATTAAATCCTTCC [4103]
OkouAu4173 ATTCCCTCGACTTTTTAGGCTATCTTTCAAGTGTAAGATTAAATCCTTCC [2264]
SclePe4347 ATTCCCTCGACTTTTTAGGCTATCTTTCAAGCGTAAGATTAAATTATTCC [3875]
StauCa4956 ATTCCCTCGACTTTCTAGGCTATCTTTCAAGTGTAAGATTAAATCCTTCC [3877]
PilgMa4954 ATTCCCTCGACGTTCTAGGCTATCTTTCAAGTATAAGATTAAATCTTTCC [3891]
PyruPu2737 ATTCCCTCGACTTTCTAGGCTATCTTTCAAGTGTACGATTAAATCCTTCC [4134]
BuckDi2735 ATTTCCTTGACTTTCTAGGTTATCTTTCAAGTGTACGATTAAATCCTTCA [4176]
ComaUm2738 ATTCCCTCGACTTTTTAGGCTATCTTTCAAGTATACGGCTAAACCCTTCA [4098]

[ 4210 4220 4230 4240 4250]
[ . . . . .]

AcanAs4051 GTGGCGCGGAGTCAAATGCTAGAAAATTCATTTATAATAGATAATGTTAT [4139]
AcanFa4053 GTGGCGCGGAGTCAAATGCTAGAAAATTCATTTATAATAGATAATGTTAT [3991]
CervTo4273 GTGGCGCGGAGTCAAATGCTAGAAAATTCATTTATAATAGATAATGTTAT [4118]
JodiRh4052 GTGGCGCGGAGTCAAATGCTAGAAAATTCGTTTATAATAGATAATGTTAT [4153]
OkouAu4173 GTGGCGCGGAGTCAAATGCTAGAAAATTCATTTATAATAGATAATGTTAT [2314]
SclePe4347 GTGGCGCGGAGTCAAATGCTAGAAAATTCATTTATAATAGATAATGTTAT [3925]
StauCa4956 GTGGCGCGGAGTCAAATGCTAGAAAATTCATTTATAATAGATAATGTTAT [3927]
PilgMa4954 GTGGCGCGGAGTCAAATGCTAGAAAATGCATTTATAATAGATAATGTTAT [3941]
PyruPu2737 GTGGCGCGGAGTCAAATGCTAGAAAATTCATTTATAATAGATAATGTTAT [4184]
BuckDi2735 GTGGTGCGGAGTCAAATGCTAGAAAATTCATTTATAATAGATGATGCTAT [4226]
ComaUm2738 GTGGTGCGGAGTCAAATGTTAGAAAATTCATTTCTAATAGATAATGTTAT [4148]

[ 4260 4270 4280 4290 4300]
[ . . . . .]

AcanAs4051 TAATAAATTGGAGCCCGTAGTTCCAATTATTCCTCTGATTGGATCATTGT [4189]
AcanFa4053 TAATAAATTGGAGCCTGTAGTTCCAATTATTCCTCTGATTGGATCATTGT [4041]
CervTo4273 TAATAAATTGGAGCCCGTAGTTCCAATTATTCCTCTGATTGGATCATTGT [4168]
JodiRh4052 TAATAAATTGGAGCCCGCAGTTCCAATTATTCCTCTGATTGGATCATTGT [4203]
OkouAu4173 TAAGAAATTGGAGCCTATAGTTCCAATTATTCCTCTGATTGGATCCTTGT [2364]
SclePe4347 TAAGAAATTGGAGCCTATAGTTCCAATTATTCCTTTGATTGGATCATTGT [3975]
StauCa4956 TAAGAAATTGGAGCCTATAGTTCCAATTATTCCTCTGATTGGATCATTGT [3977]
PilgMa4954 TAAGAAATTGGAGCCTATAGTTCCAATTATTCCTCTGATTAGATCATTGT [3991]
PyruPu2737 TAAGAAATTGGAGCCTATAGTTCCAATTATTCCTCTCATTGGATCATTGT [4234]
BuckDi2735 TAAGAAGTTCGATACCGCAGTTCCCATTAGTCCTCTGATTGGATCCTTGG [4276]
ComaUm2738 TAAGAAGTTTGATACCACAGTTCCAATTATCCYTCTGATTGGATCATTGG [4198]

[ 4310 4320 4330 4340 4350]
[ . . . . .]

AcanAs4051 ATAAAGCAAAATTTTGTAACGTCTTAGGGCATCCCGTTAGTAAATTGGTT [4239]
AcanFa4053 ATAAAGCAAAATTTTGTAACGTCTTAGGGCATCCCGTTAGTAAATTGGTT [4091]
CervTo4273 CTAAAGCAAAATTTTGTAACGTCTTAGGGCATCCCGTTAGTAAATTGGTT [4218]
JodiRh4052 CTAAAGCAAAATTTTGTAACGTCTTAGGAAATCCCGTTAGTAAATTGGTT [4253]
OkouAu4173 CTAAAGCAAAATTTTGTAACGTCTTAGGACATCCCATTAGTAAATCGGTC [2414]
SclePe4347 CTAAAGCAAAATTTTGTAACGTCTTAGGGCATCCCATTAGTAAATCGGTC [4025]
StauCa4956 CTAAAGCAAAATTTTGTAACGTCTTAGGGCATCCCATTAGTAAATTGGTC [4027]
PilgMa4954 ATAAAGCAAAATTTTGTAACGTCTTAGGGCATCCCATTAGTAAATCGGTC [4041]
PyruPu2737 CTAAAGCAAAATTTTGTACCGTCTTAGGGCATCCCATTAGTAAATCGGTC [4284]
BuckDi2735 CTAAAGCAAGATTTTGTAACGCCTTAGGACATCCCATTAGTAAGTCAGTC [4326]
ComaUm2738 CTAAAGCAAGATTTTGTAACGTCTTAGGACATCCTATTAGTAAACCTGTC [4248]

[ 4360 4370 4380 4390 4400]
[ . . . . .]

AcanAs4051 TGGGCAGATTTGGCGGATTCTGATATTATTGAGCGGTTTTGGCGTATACG [4289]
AcanFa4053 TGGGCAGATTTGGCGGATTCTGATATTATTGAACGGTTTTGGCGTATACG [4141]
CervTo4273 TGGGCAGATTTGGCGGATTCTGATATTATTGACCGGTTTTGGCGTATACG [4268]
JodiRh4052 TGGGCGGATTTGGCGGATTCTGATATTATTGACCGGTTTTGGCGTATACG [4303]
OkouAu4173 TGGGCGGATTTGACAGATTCTGATATTATTGATCGGTTTTGGCGA----- [2459]
SclePe4347 TGGGCAGATTTGGCAGATTCTGATATTATTGATCGGTTTTGGCGTATATA [4075]
StauCa4956 TGGGCAGATTTGGTGGATTCTGATATTATTGATCGGTTTTGGCGTATATA [4077]
PilgMa4954 TGGGCAGATTTGGCAGATTCCGATATTATTGACCGTTTTTGGCGTATATA [4091]
PyruPu2737 TGGGCGGATTTGGTAGATTCTGATATTATTGAACGGTTTTGGCGTATATA [4334]
BuckDi2735 TGGTCTGATTTAGCGGATTCTGATATTATTGAACGATTTTGGTGTATATG [4376]
ComaUm2738 TGGGCCGATTTAGCGGATTCTGATATTATTGACCGATTTGGGCGTATATA [4298]

[ 4410 4420 4430 4440 4450]
[ . . . . .]

AcanAs4051 CAGAAATATTTTTC--------------------------------GGGT [4307]
AcanFa4053 CAGAAATATTTTTC--------------------------GAACACGGGT [4165]
CervTo4273 CAGAAATATTTTTC--------------------------GAACACGGGT [4292]
JodiRh4052 CAGAAAAATTTTTC------------------------------------ [4317]
OkouAu4173 -------------------------------------------------- [2459]
SclePe4347 CAGAAATATTTTTC------------------------------------ [4089]
StauCa4956 CAGAAATATTTTTC-----------------------------CACGGGT [4098]
PilgMa4954 CAGAAATATTTTTCATTCGACGTTGTCTAGCGAGGAGTTCGAACACGGGT [4141]
PyruPu2737 CAGAAATATTTTTC------------------------------------ [4348]
BuckDi2735 CAGAAATATTTCTC-----------------------TTTGAACACGGGT [4403]
ComaUm2738 CAGAAATCTTTCTC------------------------------------ [4312]

[ 4460 4470 4480 4490 4500]
[ . . . . .]

AcanAs4051 GTGGGCTAAGTAAATCGATGGACAGCCTT---GGTACTATTGAAAATACC [4354]
AcanFa4053 GTGGGCTAAGTAAATCGATGGACAGCCTT---GGTACTATTGAAAATACC [4212]
CervTo4273 GTGGGCTAAGTAAATCGATGGACAGCCTT---GGTACTATTGAAAATACC [4339]
JodiRh4052 ---------------CGATGGACAGCCTT---GGTCCTATTGAAAATACC [4349]
OkouAu4173 -------------------------------------------------- [2459]
SclePe4347 --------------TCGATGGACAGCCTTGTTGGTCCTATTGAAAATACC [4125]
StauCa4956 GTGGGCTAAGTAAATCGATGGACAGCCTTGTTGGTCCTATTGAAAATACC [4148]
PilgMa4954 GTGGGCTAAGTAAATCGATGGACAGCCTTGTTGGTCCTATTGAAAATAAC [4191]
PyruPu2737 ---GGCTAAGTAAATCGATGGACAGCCTTGTTGGTCCTATTGAAAATACC [4395]
BuckDi2735 GTGGGCTAAGTAAATCAATAGGCAGTCTT---GGTCCTATTGAAAATACC [4450]
ComaUm2738 --------------------------------GGCAGTCTTGGTCATACC [4330]

[ 4510 4520 4530 4540 4550]
[ . . . . .]

AcanAs4051 AGTGGAAGTGAAGAATGGGTTTTAAATAATCCGGATAAAAACATTCATAA [4404]
AcanFa4053 AGTGGAAGTGAAGACTGGGTTTTAAATAATCCGGATAAAAACATTCATAA [4262]
CervTo4273 AGTGGAAGTGAAGAATGGGTTTTAAATAATCCGGATAAAAACATTCATAA [4389]
JodiRh4052 AGTGGAAGTGAAGACCGGGTTTTAAATAATCCGGATAAAAACATTCATAA [4399]
OkouAu4173 -------------------------------------------------- [2459]
SclePe4347 AGTGGAAGTGAAGACTGGATTTTAAATAATCCGGATAAAAACATTCATAA [4175]
StauCa4956 AGTGGAAGTGAAGACTGGGTTTTAAATAATCCGGATAAAAACATTCATAA [4198]
PilgMa4954 AGTGGAAGTGAAGACTGGGTTTTAAATAATCCGGATAAAAACATTCATAA [4241]
PyruPu2737 AGTGGAAGTGAAGACTGGGTTTTAAATAATCCGGATAAAAACATTCATAA [4445]
BuckDi2735 TGTGGAAGTGAAGACTGGGTTTTAAATAATACGGATAAAAACATTTATAA [4500]
ComaUm2738 AGTGGAAGTGAAGACCCGATTTTAAATGATACGGATAAAAACATTAATAA [4380]

[ 4560 4570 4580 4590 4600]
[ . . . . .]

AcanAs4051 TTGGGGTGATAGTGACAGTTCTAGTTACAGTAATCTTGATCATTTATTCG [4454]
AcanFa4053 TTGGGGTGATAGTGACAGTTCTAGTTACAGTAATCTTGATCATTTATTCG [4312]
CervTo4273 TTGGGGTGATAGTGACAGTTCTAGTTACAGTAATCTTGATCATTTATTCG [4439]
JodiRh4052 TTGGGGTGATAGTGACAGTTCTAGTTACAGTAATCTTGATCATTTATTCG [4449]
OkouAu4173 -------------------------------------------------- [2459]
SclePe4347 TTGGGGTGATAGTGGCAGTTTTAGTTACAGTAATCTTGATCATTTATTCA [4225]
StauCa4956 TTGGGGTGATAGTGGCAGTTTTAGTTACAGTAATCTTGATCATTTATTCA [4248]
PilgMa4954 TTGGGGTGATAGTAGCAGTTTTAGTTATAGTAATCTTGATCATTTATTCG [4291]
PyruPu2737 TTGGGGTGATAGTGGCAGTTCTAGTTACAGTAATCTTGATCATTTATTCG [4495]
BuckDi2735 TTGGGGTCATAGTGACAATTCTAGTTACAGTAATCTTGATCATTTATTCG [4550]
ComaUm2738 TTGGGGTGATAGTGACAGTTCTAATTACAGTAATCTTGATCATTTATTCG [4430]

[ 4610 4620 4630 4640 4650]
[ . . . . .]

AcanAs4051 GTGTCAAGGACATT---TGTAATTTTATCTCTGATAACACTTTGTTAGTT [4501]
AcanFa4053 GTGTCAAGGACATT---TGTAATTTTATCTCTGATAACACTTTGTTAGTT [4359]
CervTo4273 GTGTCAAGGACATT---TGTAATTTTATCTCTGATAACACTTTGTTAGTT [4486]
JodiRh4052 GTGTCAAGGACATT---TGTAATTTTATCTCTGATAAAACTTTGTTAGTT [4496]
OkouAu4173 -----------------------------------------TTGCTAGTT [2468]
SclePe4347 GTGTCAAGGACATT---TGTAATTTTATCTCTGAGAACACTTTGTTAGTT [4272]
StauCa4956 GTGTCAAGGACATT---TGTAATTTTATCTCTGAGAACACTTTGTTAGTT [4295]
PilgMa4954 GTGTCAAGGACATTATTTGTAATTTTATCTCTGAGAACACTTTGTTAGTT [4341]
PyruPu2737 GTGTCAAGGACATT---TGTAATTTTATCTCTGAGAACACTTTGTTAGTT [4542]
BuckDi2735 GTATCAAGGATATT---TGTAATTTTATCTCTGATGACACTTTATTAGTT [4597]
ComaUm2738 GTGTCAAGGACATT---TTGAATTTGATCTCTGATGACACCCTGTTAGTT [4477]

[ 4660 4670 4680 4690 4700]
[ . . . . .]

AcanAs4051 AAGGATAGAACCGGGTATGGGTATTACATATATTTTGAT------ACTGA [4545]
AcanFa4053 AAGGATAGAACCGGGTACAGGTATTACATATATTTTGAT------ACTGA [4403]
CervTo4273 AAGGATAGAACCGGGTATGGGTATTACATATATTTTGAT------ACTGA [4530]
JodiRh4052 AAGGATAGAACCGGGCACGGGTATTACATATATTTTGAT------ACTGA [4540]
OkouAu4173 AACGATAGAACTGGGTACGGTTATTATATATATTTTGAT------ACTGA [2512]
SclePe4347 AAAGATAGAACCGGGCACGGTTATTATATATATTTTGAT------ACTGA [4316]
StauCa4956 AAAGATAGAACTGGGTACGGTTATTATATATATTTTGAT------ACTGA [4339]
PilgMa4954 AAAGATAGAACTGGGTACGGTTATTATATATATTTTGAT------ACTGA [4385]
PyruPu2737 AAGGATAGAACTGGGTACGGTTATTATATATATTTTGAT------ACTGA [4586]
BuckDi2735 AGGGATAGAAATGGGTATGGTTATTACATATATTTTGATTTGGATATCGA [4647]
ComaUm2738 AGGGATCGAAATGGATATGGTTATTACATATATTTTGAT------ATTGA [4521]

[ 4710 4720 4730 4740 4750]
[ . . . . .]

AcanAs4051 AAATCATATTTTTGAAATTGATAATGATCATTCTTTTCTGAGTGAACTAG [4595]
AcanFa4053 AAATCATATTTTTGAAATTGATAATGATTATTCTTTTCTGAGTGAACTAG [4453]
CervTo4273 AAATCATATTTTTGAAATTGATAATGATCATTCTTTTCTGAGTGAACTAG [4580]
JodiRh4052 AAATCATATTTTTGAAATTGATAATGATCATTCTTTTCTGAGTGAACTAG [4590]
OkouAu4173 AAATAATAGTTTTGAGATTGATAATGATCATTCTTTTCTGAGTGAACTGG [2562]
SclePe4347 AAATAATAGTTTTGAGATTGATAATGATCATTCTTTTCTGAGTGAACTGG [4366]
StauCa4956 AAATAATAGTTTTGAGATTGATAATGATCATTCTTTTCTGAGTGAACTGG [4389]
PilgMa4954 AAATAATAGTTTTGAGATTGATAATGATCATTCTTTTCTGAGTGAACCGG [4435]
PyruPu2737 AAATAATAGTTTTGAGATTGATAATGATCATTCTTTTCTGAGTGAACTGG [4636]
BuckDi2735 AAATCAGATTTTTGGGATTGATAAGGATCATTCTTTTCTGAGTGAACTAG [4697]
ComaUm2738 AAATCGCAATTTTGAAATTGAGAATGATCATTCTTCTCTGAGTGAACTAG [4571]

[ 4760 4770 4780 4790 4800]
[ . . . . .]

AcanAs4051 AAAGTTATTTTTATACTTATCAGAAT---TCTAGTTATTTGAATAATGGA [4642]
AcanFa4053 AAAGTTATTTTTATACTTATCAGAAT---TCTAGTTATTTTAATAATGGA [4500]
CervTo4273 AAAGTTATTTTTATACTTATCAGAAT---TCTAGTTATTTGAATAATGGA [4627]
JodiRh4052 AAAGTTCTTTTTATACTTATCAGAAT---TCTAGTTATTTGAATAATGGA [4637]
OkouAu4173 AAAGTTCTTTTTATACTTATCAGAAT---TCTAGTTATCTGAATAATGGA [2609]
SclePe4347 AAAGTTCTTTTTATACTTATCAGAAT---TCTAGTTATCTCAATAATGGA [4413]
StauCa4956 AAGGTTCTTTTTATACTTATCAGAAT---TCTAGTTATCTGAATAATGGA [4436]
PilgMa4954 AAAGTTCTTTTTATACTTATCAGAAT---TATAGTTATCTGAATAATGGA [4482]
PyruPu2737 AAAGTTATTTTTATACTTATCAGAAT---TCTAGTTATCTGAATAATGGA [4683]
BuckDi2735 AAAGTTCTTTTTATACTTATCAGAAT---TTTAGTTATCTGAGTAATGGA [4744]
ComaUm2738 AAAGTTCTTTTTATACTTATCAGAAT---TCTAGTTATCTGAATAATGGA [4618]

[ 4810 4820 4830 4840 4850]
[ . . . . .]

AcanAs4051 TCGAAGAGTGATGATCCTTATTATGATCATTACATATATGATACTAAATA [4692]
AcanFa4053 TCTAAGAGTGATGATCCTTATTATGATCATTACATATATGATACTAAATA [4550]
CervTo4273 TCGAAGAGTGATGATCCTTATTATGATCATTACATATATGATACTAAATA [4677]
JodiRh4052 TCTAAGAGTGATGATCCTTCTTATGATCATTACATATATGATACTAAATA [4687]
OkouAu4173 TCTAAGAGTGATGATCCCTATTATGATCATTATATATATGATACTAAATA [2659]
SclePe4347 TCTAAGAGTGATGATCCCTATTATGATCATTATATATATGATACTAAATA [4463]
StauCa4956 TCTAAGAGTGATGATCCCTATTATGATCATTATATATATGATACTAAATA [4486]
PilgMa4954 TCTAAGAGTGATGATCCCTATTATGATCATTATATATATGATACTAAATA [4532]
PyruPu2737 TCTAAGAGTGATGATCCCTATTATGATCATTATATATATGATACTAAATA [4733]
BuckDi2735 TCTAAAAGTGACGATCCCTATTATGAC------ATGTATGATACTAAATA [4788]
ComaUm2738 TCTAAGGGTGACGGTCCTTATTATGGTCGTTACATGTATGATACTAAATA [4668]

[ 4860 4870 4880 4890 4900]
[ . . . . .]

AcanAs4051 TAGTTGGAATAATCACATTAATAATTGCATTAACTGTTATCTTCATTCTC [4742]
AcanFa4053 TAGTTGGAATAATCACATTACTAATTGCATTAACTGTTATCTTCGTTCTC [4600]
CervTo4273 TAGTTGGAATAATCACATTAATAATTGCATTAACTGTTATCTTCATTCTC [4727]
JodiRh4052 TAGTTGGAATAATCACATTACTAATTGTATTAACTGTTATCTTCATTCTC [4737]
OkouAu4173 TAGTTGGAATAATCACATTGCTAATTGCATTGACTGTTATCTTCATTCTC [2709]
SclePe4347 TAGTTGGAATAATCACATTGCTAATTGCATTGACTCTTATCTTCATTCTC [4513]
StauCa4956 TAGTTGGAATAATCACATTGCTAATTGCATTGACTGTTATCTTCATTCTC [4536]
PilgMa4954 TAGTTGGAATAATCACATTACTAATTGCATTGACTGTTATCTTCATTCTC [4582]
PyruPu2737 TAGTTGGAATAATCACATTACTAATTGCATTGACTGTTATCTTCATTCTC [4783]
BuckDi2735 TAGTTGGAATGATTACATTACGAATTGCATTGACAGTTATCTTCATTCTC [4838]
ComaUm2738 TAGTTGGAATAATCACATTACTAATTGCATTGACAGTTATCTTCACTCTC [4718]

[ 4910 4920 4930 4940 4950]
[ . . . . .]

AcanAs4051 AAATTAGTATTGATAATTTAATTTTAAGTGATAGTGACAGCCGCAGTGAC [4792]
AcanFa4053 AAATTTGTATTGATAATTTAATTTTAAGTAATAGTGACAGCCGCAGTGGC [4650]
CervTo4273 AAATTAGTATTGATAATTTAATTTTAAGTGATAGTGACAGCCGCAGTGAC [4777]
JodiRh4052 AAATTTGTATTGATAATTACATTTTAAGTGATAGTGACAGCCGCAGTGAC [4787]
OkouAu4173 AAATTTGTATTGATAATTACATTTTAAGTGATAGTGACAGCCGCAGTGAC [2759]
SclePe4347 AAATTTGTATTGATAATTACATTTTAAGTGATAGTGACAGCCGCAGTGAC [4563]
StauCa4956 AAATTTGTATTGATAATTACATTTTAAGTGATAGTGACAGCCGCAGTGAC [4586]
PilgMa4954 AAATTTGTATTGATAATTACATTTTAAGTGATAGTGACAGCCGCAGTGAC [4632]
PyruPu2737 AAATTTGTATTGATAATTACATTTTAAGTGATAGTGACAGCGCCAGTGAC [4833]
BuckDi2735 AAATTTGTATTGAGAATTCCATTTTAAGTGATAGTGACAACTATAGTGAC [4888]
ComaUm2738 AAATCTGTATTGAGAATTACATTTTAAGTGATAGTGACAACTACAGTGAC [4768]

[ 4960 4970 4980 4990 5000]
[ . . . . .]

AcanAs4051 AGTTACATTTATAGTTTAATTTTTGATGAAAGTCGA------AATAGTAG [4836]
AcanFa4053 AGTTACATTTATAGTTTCATTTTTGATGAAAGTCGA------AATAGTAG [4694]
CervTo4273 AGTTACATTTATAGTTTAATTTTTGATGAAAGTCGA------AATAGTAG [4821]
JodiRh4052 AGTTACATTTATAGTTTCATTTTTGATGAAAGTCGA------AATAGTAG [4831]
OkouAu4173 AGTTACATTTATAGTTTCATTTGTGATGAAAGTCGA------AATAGTAG [2803]
SclePe4347 AGTTACATTTATAGTTTCATTTGTGATGAAAGTCGA------AATAGTAG [4607]
StauCa4956 AGTTACATTTATAGTTTCATTTGTGATGAAAGTCGA------AATAGTAG [4630]
PilgMa4954 AGTTACATTTATAGTTTCATTTGTGATGAAAGTCGA------AATAGTAG [4676]
PyruPu2737 AGTTACTTTTATAGTTTCATTTGTGATCAAAGTCGA------AATAGTAG [4877]
BuckDi2735 AGTCACATTTATAGTTTCATTTGTGATAAAAGTGGA------AATAGTAG [4932]
ComaUm2738 AGTTACATTTATAGTTTCATTTGTGATGAAAGTGGAAGTGAGAATAGTAG [4818]

[ 5010 5020 5030 5040 5050]
[ . . . . .]

AcanAs4051 TAAAAGCGTGAATTCCGGTATAAGANCTANCACGAAGGGTAGTGATTTAA [4886]
AcanFa4053 TAAAAGCGTGAATTCCGGTATAAGACCTAGCACGAAGGGTAGTGATTTAA [4744]
CervTo4273 TAAAAGCGTGAATTCCGGTATAAGACCTAGCACGAAGGGTAGTGATTTAA [4871]
JodiRh4052 TAAAAGCGTGAATTCCGGTATAAGACCTAGCACGAAGGGTAGTGTTTTAC [4881]
OkouAu4173 TAAAAGTGTGAATTCCGGTATAAGACCTAGCACAAAGGATAGTGATTTAA [2853]
SclePe4347 TAAAAGTGTGAATTCCGGTATAAGACCTAGCACAAAGGATAGTGATTTAA [4657]
StauCa4956 TAAAAGTGTGAATTCCGGTATAAGACCTAGCACAAAGGATAGTGATTTAA [4680]
PilgMa4954 TAAAAGTGTGAATTCCGGTATAAGACCTAGCACAAAGGATAGTGATTTAA [4726]
PyruPu2737 TAAAAGCGTGAATTCCGGTATAAGACCTAGCACAAAGGATAGTGATTTAA [4927]
BuckDi2735 TGAAAGCGAGAATTCCAGTATAAGAACTCGCACGAATGGTAGTGATTTAA [4982]
ComaUm2738 TGAAAGAGAGAATTCCAGTATAAGAACTAGTACGAATAGTAGTGATTTTA [4868]

[ 5060 5070 5080 5090 5100]
[ . . . . .]

AcanAs4051 CTAGAAGAGAAAGTTCTAATGATCCCCATGNAATTAAAAAGTACCGTAAT [4936]
AcanFa4053 CTAGAAGAGAAAGTTCTAATGATCCCAATGTAATTAAAAAGTACAGTAAT [4794]
CervTo4273 CTAGAAGAGAAAGTTCTAATGATCCCAATGTAATTAAAAAGTACAGTAAT [4921]
JodiRh4052 CTAGAAGAGAAAGTTCTAATGATCCCAATGTAATTAAAAAGTACAGTAAT [4931]
OkouAu4173 CTAGAAGGGAGGGTTCTAATGATCCCAATGTAATTAAAAAGTACAGGAAT [2903]
SclePe4347 CTAGAAGAGAGGGTTCTAATGATCCCAATGTAATTAAAAAGTACAGGAAT [4707]
StauCa4956 CTAGAAGAGAGGGTTCTAATGATCCCAATGTAATTAAAAAGTACAGGAAT [4730]
PilgMa4954 CTAGAAGAGAGGGTTCTAATGATCCCAATGTAATTAAAAAGTACAGGAAT [4776]
PyruPu2737 CTAGAAGAGAGGGTTCTAATGATCCCAATGTAATTAAAAAGTACAGGAAT [4977]
BuckDi2735 CTATAAGAGAAGGTTCTAATGACCCCGATGTAACTCAAAAATACAGGCAT [5032]
ComaUm2738 CTATAAGAGCAGGTTCGAATGATCTCGATGTAACTCAAAAATACAGGCAT [4918]

[ 5110 5120 5130 5140 5150]
[ . . . . .]

AcanAs4051 TTGTGGGTTCAATGCGAAAGTTGTTATGAATTAAATTATAAGAAATTTTT [4986]
AcanFa4053 TTGTGGGTTCAATGCGAAAGTTGTTATGAATTAAATTATAAGAAATTTTT [4844]
CervTo4273 TTGTGGGTTCAATGCGAAAGTTGTTATGAATTAAATTATAAGAAATTTTT [4971]
JodiRh4052 TTGTGGGTTCAATGCGAAAGTTGTTATGGATTAAATTATAATAAATTTTT [4981]
OkouAu4173 TTGTGGGTTCAATGCGAAAGTTGTTATGAATTAAATTATAAGAAATTTTT [2953]
SclePe4347 TTGTGGGTTCAATGCGAAAGTTGTTATGAATTAAATTATAATAAATTTTT [4757]
StauCa4956 TTGTGGGTTCAATGCGAAAGTTGTTATGAATTAAATTATAATAAATTTTT [4780]
PilgMa4954 TTGTGGGTTCAATGCGAAAGTTGTTATGAATTAAATTATAAGAAATTTTT [4826]
PyruPu2737 TTGTGGGTTCAATGCGAAAGTTGTTATGAATTAAATTATAAGAAATTTTT [5027]
BuckDi2735 TTATGGGTTCAATGCGAAAATTGTTATGGATTAAATTATAAAAGATTTTT [5082]
ComaUm2738 TTATGGGTTCAATGCGAAAATTGTTATGGATTAAATTATAAGAAATTTTT [4968]

[ 5160 5170 5180 5190 5200]
[ . . . . .]

AcanAs4051 GAAGTCAAAAATGAATATTTGCGAACACTGTGGATATTATTTGAAAATGA [5036]
AcanFa4053 GAAGTCAAAAATGAATATTTGTGAACACTGTGGATATTATTTGAAAATGA [4894]
CervTo4273 GAAGTCCAAAATTAATATTTGTGAACACTGTGGATATCATTTGAAAATGA [5021]
JodiRh4052 GAAGTCAAAAATGAATATTTGTGAACACTGTGGATATCATTTGAAAATGA [5031]
OkouAu4173 GAAGTCAAAAATGAATATTTGTGAACACTGTGGATATCATTTGAAAATGA [3003]
SclePe4347 GAAGTCAAAAATGAATATTTGTGAACACTGTGGATATCATTTGAAAATGA [4807]
StauCa4956 GAAGTCAAAAATGAATATTTGTGAACACTGTGGATATCATTTGAAAATGA [4830]
PilgMa4954 GRAGTCAAAAATGAATATTTGTGAACACTGCGGATATCATTTGAAAATGA [4876]
PyruPu2737 GAAGTCAAAAATGAATATTTGTGAACACTGTGGATATCATTTGAAAATGA [5077]
BuckDi2735 GAAGTCAAAAATGCATATTTGTGAACAATGTGGATATCATTTGAAAATGA [5132]
ComaUm2738 G------------------------------------------------- [4969]

[ 5210 5220 5230 5240 5250]
[ . . . . .]

AcanAs4051 GTAGTTCAGATAGAATCGAACTTTTGATTGATCCAGGTACTTGGGATCCT [5086]
AcanFa4053 GTAGTTCAGATAGAATCGAACTTTTGATTGATCCAGGCACTTGGGATCCT [4944]
CervTo4273 GTAGTTCAGATAGAATCGAACTTTTGATTGATCCAGGTACTTGGGATCCT [5071]
JodiRh4052 GTAGTTCAGATAGAATCGAACTTTTGATTGATCCAGGTACTTGGGATCCT [5081]
OkouAu4173 GTAGTTCAGATAGAATCGAACTTTTGATTGATCCAGGTACTTGGGATCCT [3053]
SclePe4347 GTAGTTCAGATAGAATCGAACTTTTGATTGATCCAGGTACTTGGGATCCT [4857]
StauCa4956 GTAGTTCAGATAGAATCGAACTTTTGATTGATCCAGGTACTTGGGATCCT [4880]
PilgMa4954 GTAGTTCAGATAAGATCGAACTTTTGATTGATCCAGGTACTTGGGATCCT [4926]
PyruPu2737 GTAGTTCAGATAGAATCGAACTTTTGATTGATCCAGGTACTTGGGATCCT [5127]
BuckDi2735 GTAGTTCGGAAAGAATCGAACTCTTGATTGATCCAGGTACTTGGGATCCT [5182]
ComaUm2738 -------------------------------------------------- [4969]

[ 5260 5270 5280 5290 5300]
[ . . . . .]

AcanAs4051 ATGTATGAAGACATGGTATCTTTGGACCCCATTGAATTTCATTCGGAGGA [5136]
AcanFa4053 ATGTATGAAGACATGGTATCTTTGGACCCCATTGAATTTCATTCGGAGGA [4994]
CervTo4273 ATGTATGAAGACATGGTATCTCTGGACCCCATTGAATTTCATTCAGAGGA [5121]
JodiRh4052 ATGTATGAAGACATGGTATCTCTGGACCCCATTGAATTTCATTCGGAGGA [5131]
OkouAu4173 ATGGATGAAGACATGGTATCTCTGGATCCCATTGAGTTTCATTCGGAAGA [3103]
SclePe4347 ATGGATGAAGACATGGTATCTCTGGATCCCATTGAGTTTCATTCGGAAGA [4907]
StauCa4956 ATGGATGAAGACATGGTATCTCTGGATCCCATTGAGTTTCATTCGGAAGA [4930]
PilgMa4954 ATGGATGAAGACATGGTATCTCTGGATCCCATTGAGTTTCATTCGGAAGA [4976]
PyruPu2737 ATGGATGAAGACATGGTATCTCTGGATCCCATTGAGTTTCATTCGGAAGA [5177]
BuckDi2735 ATGAATGAAGACATGGTATCTCTGGATCCCATTGAATTTCATTCGGAAGA [5232]
ComaUm2738 -------------------------------------------------- [4969]

[ 5310 5320 5330 5340 5350]
[ . . . . .]

AcanAs4051 GGAACTTTATAAAGATCGTGTCGATTCTTATCAAAGAAAAACAGGATTAA [5186]
AcanFa4053 GGAACTTTATAAAGATCGTGTCGATTCTTATCAAAGAAAAACAGGATTAA [5044]
CervTo4273 GGAACTTTATAAAGATCGTGTCGATTCTTATCAAATAAAAACAGGATTAA [5171]
JodiRh4052 GGAACTTTATAAAGATCGTGTCGATTCTTATCAAAGAAAAACAGGATTAA [5181]
OkouAu4173 GGAACTTTATAAAGACCGTGTCGATCCTTATCAAAGAAAGACAGGATTAA [3153]
SclePe4347 GGAACTTTATAAAGATCGTGTCGATTCTTATCAAAGAAAAACAGGATTAA [4957]
StauCa4956 GGAACTTTATAAAGATCGTGTCGATTCTTATCAAAGAAAAACAGGATTAA [4980]
PilgMa4954 GGAACTTTATAAAGATCGTGTCGATTCTTATCAAAGAAAAACAGGATTAA [5026]
PyruPu2737 GGAACTTTATAAAGATCGTGTCGATTCTTATCAAAGAAAAACAGGATTAA [5227]
BuckDi2735 GGAACTTTATAAGGATCGTATCGATTCTTATCAAAGAAAGACAGGATTAA [5282]
ComaUm2738 -------------------------------------------------- [4969]

[ 5360 5370 5380 5390 5400]
[ . . . . .]

AcanAs4051 CTGAGGCTATTCAAACGGGCATAGGTCAGCTAAACGGTATTCCCATAGCA [5236]
AcanFa4053 CTGAGGCTATTCAAACGGGCATAGGTCAGCTAAACGGTATTCCCATAGCA [5094]
CervTo4273 CTGAGGCTATTCAAACGGGCATAGGTCAGCTAAACGGTATTCCCATAGCA [5221]
JodiRh4052 CTGAGGCTATTCAAACGGGCATAGGTCAGCTAAACGGTATTCCCATAGCA [5231]
OkouAu4173 CGGAGGCTRTTCAAACGGGCATAGGTCGATTAAAYGGTATTCCCATAGCA [3203]
SclePe4347 CGGAGGCTATTCAAACGGGCATAGGTCGGCTAAACGGTATTCCCATAGCA [5007]
StauCa4956 CGGAGGCTATTCAAACGGGCATAGGTCGGCTAAACGGTATTCCCATAGCA [5030]
PilgMa4954 CGGAAGCTATTCAAACGGGCATAGGTCGGCTAAACGGTATTCCCATAGCA [5076]
PyruPu2737 CGGAGGCTATTCAAACGGGCATAGGTCGGCTAAACGGTATTCCCATAGCA [5277]
BuckDi2735 CGGAGGCCGTTCAAACGGGCATAGGTCAGCTAAACGGTATTCCCATAGCA [5332]
ComaUm2738 -------------------------------------------------- [4969]

[ 5410 5420 5430 5440 5450]
[ . . . . .]

AcanAs4051 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCCGTAGT [5286]
AcanFa4053 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCCGTAGT [5144]
CervTo4273 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCCGTAGT [5271]
JodiRh4052 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCCGTAGT [5281]
OkouAu4173 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCTGTAGT [3253]
SclePe4347 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCTGTAGT [5057]
StauCa4956 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCTGTAGT [5080]
PilgMa4954 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCTGTAGT [5126]
PyruPu2737 ATTGGAGTTATGGATTTTCGGTTTATGGGGGGTAGTATGGGATCTGTAGT [5327]
BuckDi2735 ATTGGAGTTATGGATTTTCAGTTTATGGGGGGTAGTATGGGATCCGTAGT [5382]
ComaUm2738 -------------------------------------------------- [4969]

[ 5460 5470 5480 5490 5500]
[ . . . . .]

AcanAs4051 AGGGGAGAAAATCGCCCGTTTGATCGAGTATGCTACCAATCAATTTCTCC [5336]
AcanFa4053 AGGGGAGAAAATCGCCCGTTTGATCGAGTATGCTACCAATCAATTTCTAC [5194]
CervTo4273 AGGGGAGAAAATCGCCCGTTTGATCGAGTATGCTACCAATCAATTTCTAC [5321]
JodiRh4052 AGGGGAGAAAATCGCACGTTTGATCGAGTATGCTACCAATCAATTTCTAC [5331]
OkouAu4173 AGGGGAGAAAATCACCCGTTTGATCGAGTACGCTACCAATCAATGTCTAC [3303]
SclePe4347 AGGGGAGAAAATAACCCGTTTGATCGAGTATGCTACCAATCAATTTCTAC [5107]
StauCa4956 AGGGGAGAAAATCACCCGTTTGATCGAGTATGCTACCAATCAATTTCTAC [5130]
PilgMa4954 AGGGGAGAAAATCACCCGTTTGATCGAGTATGCTACCAATCAATTTCTAC [5176]
PyruPu2737 AGGGGAGAAAATCACCCGTTTGATCGAGTATGCTACCAATCAATTTCTAC [5377]
BuckDi2735 AGGGGAAAAAATCACCCGTTTGATCGAGTATGCTACCAATCAATTTCTGC [5432]
ComaUm2738 -------------------------------------------------- [4969]

[ 5510 5520 5530 5540 5550]
[ . . . . .]

AcanAs4051 CTCTTATTATAGTGTGTGCTTCCGGG------------------------ [5362]
AcanFa4053 CTCTTATTATAGTGTGTGCTTCCGGGGGTGCACGCATGCAAGAAGGAAGT [5244]
CervTo4273 CTCTTATTATAGTGTGTGCTTCCGGGGGTGCACGCATGCAAGAAGGCAGT [5371]
JodiRh4052 CTCTTATTATAGTGTGTGCTTCCGGGGGTGCACGCATGCAAGAAGGAAGT [5381]
OkouAu4173 CGCTTATCATAGTGTGTGCTTCGGGAGGTGCACGCATGCAAGAAGGAAGT [3353]
SclePe4347 CGCTTATTATAGTGTGTGCTTCCGGAGGTGCACGCATGCAAGAAGGAAGT [5157]
StauCa4956 CGCTTATTATAGTGTGTGCTTCCGGAGGTGCACGCATGCAAGAAGGAAGT [5180]
PilgMa4954 CGCTTATTATAGTGTGTGCTTCCGGAGGTGCACGCATGCAAGAAGGAAGT [5226]
PyruPu2737 CGCTTATTATAGTGTGTGCTTCCGGAGGTGCACGCATGCAAGAAGGAAGT [5427]
BuckDi2735 CTCTTATTATAGTGTGTGCTTCTGGAGGGGCACGCATGCAAGAAGGAAGT [5482]
ComaUm2738 -------------------------------------------------- [4969]

[ 5560 5570 5580 5590 5600]
[ . . . . .]

AcanAs4051 -------------------------------------------------- [5362]
AcanFa4053 TTGAGCTTGATTCAAATGGCTAAAATATCTTCTGCTTTATATGATTATCA [5294]
CervTo4273 TTGAGCTTGATTCAAATGGCTAAAATATCTTCTGCTTTATATGATTATCA [5421]
JodiRh4052 TTGAGCTTGATTCAAATGGCTAAAATATCTTCTGCTTTATATGATTATCA [5431]
OkouAu4173 TTGAGCTTGATGCAAATGGCTAAAATATCGTCTGCTTTATATGATTACCA [3403]
SclePe4347 TTGAGCTTGATGCAAATGGCTAAAATATCTTCTGCTTTATATGATTACCA [5207]
StauCa4956 TTGAGCTTGATGCAAATGGCTAAAATATCTTCTGCTTTATATGATTACCA [5230]
PilgMa4954 TTGAGCTTGATGCAAATGGCTAAAATATCTTCTGCTTTATATGATTACCA [5276]
PyruPu2737 TTGAGCTTGATGCAAATGGCTAAAATATCTTCTGTTTTATATGATTACCA [5477]
BuckDi2735 TTGAGCTTGATGCAAATGGCTAAAATATCTTCGACTTTATATGATTATCA [5532]
ComaUm2738 -------------------------------------------------- [4969]

[ 5610 5620 5630 5640 5650]
[ . . . . .]

AcanAs4051 -------------------------------------------------- [5362]
AcanFa4053 ATCAAATAAAAAGTTATTATATATATCCATTCTTACATCTCCAACTACAG [5344]
CervTo4273 ATCAAATAAAAAGTTATTATATATATCCATTCTTACATCTCCCACTACAG [5471]
JodiRh4052 ATCAAATAAAAAGTTATTATATATATCCATTCTTACATCTCCCACTACAG [5481]
OkouAu4173 ATCAAATAAAAAGTTATTATATATATCCATCCTTACATCTCCCACTACTG [3453]
SclePe4347 ATCAAATAAAAAGTTATTATATATATCCATCCTTACATCTCCCACTACTG [5257]
StauCa4956 ATCAAATAAAAAGTTATTATATATATCCATCCTTACATCTCCCACTACTG [5280]
PilgMa4954 ATCAAATAAAAAATTATTATATATATCCATCCTTACATCTCCCACTACTG [5326]
PyruPu2737 ATCAAATAAAAAGTTATTATATATATCCATCCTTACATCTCCCACTACTG [5527]
BuckDi2735 ATCAAATAAAAAGTTATTCTATATATCCATCCTTACATCTCCTACTACTG [5582]
ComaUm2738 -------------------------------------------------- [4969]

[ 5660 5670 5680 5690 ]
[ . . . . ]

AcanAs4051 -------------------------------------------- [5362]
AcanFa4053 GTGGGGTGACGGCTAGTTTTGGTATGCTGGGGGATATCATTATT [5388]
CervTo4273 GTGGGGTGACGGCTAGTTTTGGTATGCTGGGGGATATCATTATT [5515]
JodiRh4052 GTGGGGTGACGGCTAGTTTTGGTATGCTGGGGGATATCATTC-- [5523]
OkouAu4173 GTGGGGTGACGGCKAGTTTTGGTATGTTGGGAGATATCAT---- [3493]
SclePe4347 GTGGGGTAACGGCTAGTTTTGGTATGCTGGGGGATATCAT---- [5297]
StauCa4956 GTGGGGTGACGGCTAGTTTTGGTATGCTGGGGGATATCATTATT [5324]
PilgMa4954 GTGGGGTGACGGCTAGTTTTGGTATGCTGGGGGATATCATTATT [5370]
PyruPu2737 GTGGGGTGACGGCTAGTTTTGGTATGCTGGGGGATATCATT--- [5568]
BuckDi2735 GTGGGGTGACAGCTAGTTTTGGTATGTTGGGGGATATCGTTATT [5626]
ComaUm2738 -------------------------------------------- [4969]
;
END;