#NEXUS 
[See Nickrent, D. L., K. P. Schuette, and E. M. Starr.  1994.  A molecular phylogeny of Arceuthobium (Visaceae) based on]
[nuclear ribosomal DNA internal transcribed spacer sequences.  American Journal of Botany 81:1149-1160.  This study ]
[examined 22 dwarf mistletoe taxa.  Since then, two other taxa have been sequenced and they are added to the matrix below.]
[These are A. hawksworthii (related to A. vaginatum) and A. aureum ssp. aureum (related to A. globosum).  The original ]
[analysis resulted in six shortest trees whereas the 24-taxon data set results in only two.  None of the major results ]
[from the original analysis have changed.  For the particularly observant among you, you may have noticed that a "!" was ]
[placed three bp from the end of the sequences of A. oxycedi (Old World) and A. abietis-religiosae (Mexico).  This was meant ]
[to specify that these taxa have longer ITS sequences just 5' of the 26S rDNA that were not present in any other taxon. ]
[Additional work is needed, especially sampling among the many Asian species of Arceuthobium.]

BEGIN DATA;
DIMENSIONS  NTAX=24 NCHAR=604;
FORMAT DATATYPE=DNA  MISSING=? GAP=-  INTERLEAVE ;OPTIONS  MSTAXA=UNCERTAIN ;

MATRIX

[                             10        20        30        40        50        60        70        80        90        100]
[                             .         .         .         .         .         .         .         .         .         .]

Aoxycedri            GTATGCTTTTGAAGAGGAGTGACAAATAACAAGTTAATAAAATTTTAGGTCGTTGAC-TTGTAG-ACTTTGCGCATTTGGTTTGCAAGCCACGTGTGCCA   [98]
Aabietis_rel         T-ATGCTTTTGAAGAGGAGTGACAAAGAACAAGTTAATAAAATTTTAGGTCGTTGACCTTGTAG-ACTTTGCGCATTTGGTTTGCAAGCCACGTGTGCCA   [98]
Averticilliflorum    TCGTGCTTTAAAGGATGAATGACAAGTCACAAGTTAAACTA-TCCTAGATCTCTGATCTAGTGGGACATTTGGCACATTGTCAGTGA-T-ATGTGTTCGC   [97]
Aamericanum          TCGTGCTCTTAAAGATGAATGACAAATAATAAGTTACACTA-TCCTAGATCGATGATCTAGTAGGACATTTGACACATTGTCAGGGAAT-ATGTGCTCTC   [98]
Aguatemalense        TCATGCTTTCAAAGATGAATGACAAGTAACATGTGTACCTA-TTTTAGATCATTGATCTATCAGACCATTCGATACATTGTGAGCAAAG-ATGTATGTGT   [98]
Apendens             TCATGCTTTCAAAGATGAATGACAAGTAACATGTGTCCCTA-TTTTTGATCATTGATCTATCGGTGCATTCGATACATGGCGAGCGAAT-ATGTATGAGT   [98]
Apusillum            TCATACTTTTAAAGATGAACCACATGCAATAAGTTAAGCTG-TTTTAGATCCTTGATCCAATAGAACATTCATCACACGATTGGTGAAC-ATGTGTGTGT   [98]
Abicarinatum         TCATGCTTTTAAAGATGA-CGACATGCAATA-GTTAAGCTG-TTTTAGATCGTTGATCCAATTGAACATTCATCACACGATTGGCGAAC-ATGTGTGTGT   [96]
Adouglasii           TCATGCTTTTAAAGATGAATGACAAGCAAAAAGTTAAGCTA-TTTTAGATCGTTGATCTAATAGAACATTCTACACATGGTTGGCGAAC-ATGTGTGTGT   [98]
Adivaricatum         TCGTGCTTKTAAAGATGAGTGACAAGCAAAAAGTTAAGACA-TTTTAGATCGCTGATCTAGTGGAACATTCGACACATTGTTGGTGAAC-ATGTGCGTGT   [98]
Adurangense          TCATGCCTTTAAAGATGAATGACAAGCAATAAGTTAAGCTA-TTTTAGATCGTTGATCTAATAGAACATTCGACACATGGTTGGCGAAC-ATGTGTGCGT   [98]
Avagcrypt            TCATGCCTTTAGAGATGAATGACAAGCAATAAGTTAAGCTA-TTTTAGATCGTTGATCTAATAGAACATTCGACACATGGTTGGCGAAC-ATGTGTGCGT   [98]
Avagvag              TCATGCTTTTAAAGATGAATGACAAGCAATAAGTTAAGCTA-TTTTAGATTGTTGATCTAATAGAACATTCGACACATGGTTGGCGAAT-ACGTGTGCGT   [98]
Ahawksworthii        TCATGCTTTTAAAGATGAATGACAAGCAATAAGTTAAGCTA-TTTTAGATCGTTGATCTAATAGAATATTCGACACATGGTTGGCGAAC-ATGTGTGCGT   [98]
Aglobosum            TCATACTTTTAAAGATGAATGACAAGCAACAAGTTAAGCTA-TTTTAGATCGTTGATCTAATAGAACATTCGATACATTGTTGGTGAAC-ATGTGTG--T   [96]
Aaureum              TCATACTTTTAAAGATGAATGACAAGCAACAAGTTAAGCTA-TTTTAGATCGTTGATCTAATAGAACATTCGATACATTGTTGGTGAAC-ATGTGTG--T   [96]
Anigrum              TCATGCCTTTAAAGATGAATGACAAGCAATA-GTTAAGCTA-TTTTAGATCGTTGATCTAATAGAACATTCGACACATGGTTGGCGAAC-ATGTGTGCGT   [97]
Agillii              TCATGCTTTTAAAGATGAATGACAAGCAATAAGTTAAGCTA-CTTTAGATCGTTGATCTA-TATAACATGCGACACATGGTTGGCGAAC-ATGTGTGTGT   [97]
Arubrum              TCATGCTTTTAAAGATGATTGACAAGCAATAAGTGAAGCTA-TTTTAGGTCGTTGATCTA-TAAAAYATTCGATACATGGTTGGCGAAC-ATGTGCGAGT   [97]
Astrictum            TCATGCTTTTAAAGATGAATGACAAGCAATTGGTTGAGCTA-TTTTAGATCGTTGATCTAATAAGACATTCGACACGTGGTTGGCGAAC-ATGTGTGCGT   [98]
Aabietinummag        TCATRCTTTTAAAGATGAATRACAAGTAAAGAGTTAATCTA-TMTTAGATCGTTGATCTAATAGAACATTCGATACATGGTTGGCGAAC-ATGTGTGCGC   [98]
Aapachecum           TCATGCTTTTAAAGATGAATGACAAGTAAAGAGTTAATCTA-TTTTAGATCGTTGATCTAATAGAACATTCGATACATGGTTGGCGAAC-ATGTGTGCGC   [98]
Acampylopodum        TCATGCTTTTAAAGATGAATGACAAGTAAAGAGTTAATCTA-TTTTAGATCGTTGATCTAATAGAACATTCGATACATGGTTGGCGAAC-ATGTGTGCGC   [98]
Amicrocarpum         TCATGCTTTTAAAGATGAATGACAAGTAAAGAGTTAATCTA-TTTTAGATCGTTGATCTAATAGAACATTCGATACATGGTTGGCGAAC-ATGTGTGCGC   [98]

[                             110       120       130       140       150       160       170       180       190       200]
[                             .         .         .         .         .         .         .         .         .         .]

Aoxycedri            TTATATCTATAACAAATCGGCKCGGAATGTGCCAAGGAAATAAAAAATGTTA--CATTTTTACATTTAG-CATGTCG-TTGCTTTGT-GTAAAGGTGATG   [193]
Aabietis_rel         TTATATCTATAACAAATCGGCTCGGAATGTGCCAAGGAAATAAAAAATGTTA--CATTTTTACATTTAG-CATGTCG-TTGCTTTGT-GTAAAGGTGATG   [193]
Averticilliflorum    TTGTTTCCATAATAAATTGGCACGGAATGTGGCAAGGAA-TATAAAATAATGTTCCTCCTTTAAATGCGATACCTTG-TTATTTTTT-GTAAAGGTGGAG   [194]
Aamericanum          TTGTTCCAAATATAAATTGACACGGAATGTGGCAAGGAA-TAGAAAATGATGTTCCTCCTTTAAATGCGATACCTTG-TTATTTTCT-GTAAAGGTGGAG   [195]
Aguatemalense        GTGTTTCATTTATAAATCGGCACGAAATGTGCCAAGGAA-AAGAAGATATTGCACCTCCTTTAAATATGGCACATTG-TTATTTCTT-ATAAGGGTGGCG   [195]
Apendens             TTGTTTCAATTACAATTTGACACGAAATGTGCCAAGGAA-AAGAAGATATTGCTCCTCCTTTGAATGTAATACATTG-TTATTTTTT-ATAAGGGTGGCG   [195]
Apusillum            TTGTTTTAATTATGAATCGGTACGAAATGTACCAAGGAA-AAGATAATACCGTCACTCCTTTAAATGAGAAACATTGATTTTCTTTT-ACAAGTGTGGAG   [196]
Abicarinatum         TTGTTTTAATTATGAATCGGTACGAAATGTTCCAAGGAA-AAGATAATATTGTCCCTCCTTTAAATGAGACACGTTGATTTTCTTTT-ACAATGGTGGAG   [194]
Adouglasii           TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAA-AAGAAAATATTGTTCCTCCTTCAAATGAGACACGTTA-C----TTTT-GTAAG-GTGGAG   [190]
Adivaricatum         TTGTTTCAATTATGAACCGGTACGAAATGTGCCAAGGAA-AGGAAAATATTGTCCCTCCTTTGAATGAGACACGTTG-CTATTTTTT-ATAAGGGTGGAG   [195]
Adurangense          TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAA-GCGAAAATATTATTCCTCCTTTAAATGAGATACATTG-TTATTTTTT-ATAAGGGCGGAG   [195]
Avagcrypt            TTGTTTAAATTATGAATCGGTACGAAATGTGCCAAGGAA-ACGAAAATATTATTCCTCCTTTAAATGAGATACATTG-TTATTTTTT-ATAAGGGCGGAG   [195]
Avagvag              TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAA-AAGAAAACATTATTCCTCCTTTAAATGAGGTACATTG-TTATTTTTT-GTAAGGGCGGAG   [195]
Ahawksworthii        TTGTTCTAATAATGAATCGGTACGAAATGTGCCAAGGAA-AAGAAAATATTATTCCTCCTTTAAATGAGATATATTG-TTATTTTTTTATGAGGGCGGAG   [196]
Aglobosum            TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAA-AAGAAAATATTGTCCCTCCTATAAATGATACACATTG-TTATTTTTT-ATAAGGCTGGAG   [193]
Aaureum              TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAA-AAGAAAATATTGTCCCTCCTATAAATGATACACTTTG-TTATTTTTT-ATAAGGCTGGAG   [193]
Anigrum              TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAA-GCGAAAATATTATTCCTCCTTTAAATGAGATACATTG-TTATTTTTT-ATAAGGGCGGAG   [194]
Agillii              TTGTTTGAATTATGATTCGGTACGAAATGTGCCAAGAAA-AAGAAAATATTATTCCTTTTTTAAATGAGACACGCTG-TTATTTTTT-ATAAGGGTGGAG   [194]
Arubrum              TTGTTTTAATAATGATTCGGTACAAAATGTGCCAAGGAA-AAGAAAACATTGTTCCTCCTTTAAATGAGATACATTG-TTATTTTTT-ATAAGGGTGGAG   [194]
Astrictum            TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAA-AAGAATATATTATTCCTCCGTTAAATGAGATACATTA-TTATTTTTT-ATAAGGGCGAAG   [195]
Aabietinummag        TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAG-AAGGAAATATTGTTCCCCCTTTAAATGAGACATATTG-TTATTTTTT-ATAGGGGTGGAG   [195]
Aapachecum           TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAG-AAGGAAATATTGTTCCCCCTTTAAATGAGACATATTG-TTATTTTTT-ATAGGGGTGGAG   [195]
Acampylopodum        TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAG-AAGGAAATATTGTTCCCCCTTTAAATGAGACATATTG-TTATTTTTT-ATAGGGGTGGAG   [195]
Amicrocarpum         TTGTTTTAATTATGAATCGGTACGAAATGTGCCAAGGAG-AAGGAAATATTGTTCCCCCTTTAAATGAGACATATTG-TTATTTTTT-ATAGGGGTGGAG   [195]

[                             210       220       230       240       250       260       270       280       290       300]
[                             .         .         .         .         .         .         .         .         .         .]

Aoxycedri            TTCATAGAGCAATA---T-AAT-GACTCTCAACAACGAATATCTTGACTCTCGCATCGATGAAGAACGCAGCGAAATGCGACACATAGTGTGAATTGCAG   [288]
Aabietis_rel         TTCATAGAGCAATA---T-AAT-GACTCTCAACAACGAATATCTTGACTCTCGCATCGATGAAGAACGCAGCGAAATGCGACACATAGTGTGAATTGCAG   [288]
Averticilliflorum    ATT-TAAT-CAATAAT-TAAAT-GACTCCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAG   [290]
Aamericanum          ATT-TAAT-CAATAAT-TAAAT-GACTCCCGACAATGGATATCTTGACTCTCATATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAG   [291]
Aguatemalense        ATT--?AT-CAATAAT-CAAAT-GACTCCCAATAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [290]
Apendens             ATT--AAT-CAATAAT-CAAAT-GACTCCCAATAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [290]
Apusillum            ATT-TAAT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGGTGTGAATTGCAG   [292]
Abicarinatum         ATT--AAT-CAATAAT-CGAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACTTGGTGTGAATTGCAG   [289]
Adouglasii           ATT--AAT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGGTGTGAATTGCAG   [285]
Adivaricatum         ATT--AAT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCAGCACATGGTGTGAATTGCAG   [290]
Adurangense          ATT--ATT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGGTGTGAATTGCAG   [290]
Avagcrypt            ATT-TATT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGGTGTGAATTGCAG   [291]
Avagvag              ATT--ATT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGGTGTGAATTGCAG   [290]
Ahawksworthii        ATT--ATT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGTTGTGAATTGCAG   [291]
Aglobosum            ATT--AAT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [288]
Aaureum              ATT--AAT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [288]
Anigrum              ATT--ATT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGGTGTGAATTGCAG   [289]
Agillii              ATT--ATT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGGTGTGAATTGCAG   [289]
Arubrum              ATT--AAT-TAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGACACATGGTGTGAATTGCAG   [289]
Astrictum            ATC--ATT-CAATAAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTATCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [290]
Aabietinummag        ATT--AAT-CAATAGT-CAAATAGGCTTCCAACAATGGATATCTTGACTCTCGTACCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [291]
Aapachecum           ATT--AAT-CAATGAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTACCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [290]
Acampylopodum        ATT--AAT-CAATGAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTACCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [290]
Amicrocarpum         ATT-TAAT-CAATGAT-CAAAT-GACTTCCAACAATGGATATCTTGACTCTCGTACCGATGAAGAACGTAGCAAAATGCGATACATGGTGTGAATTGCAG   [291]

[                             310       320       330       340       350       360       370       380       390       400]
[                             .         .         .         .         .         .         .         .         .         .]

Aoxycedri            AATCCCGTGAATCATCAAATCTTTGAACGCAAGTTGCGCCTAAAACCAATTTTAGGTTTAGGGCATGCTTGCTTGGGTGTCGAGT-G-TAAG-TCACTTG   [385]
Aabietis_rel         AATCCCGTGAATCATC-AATCTTTGAACGCAAGTTGCGCCTAAAACCAATTTTAGGTTTAGGGCATGCTTGCTTGGGTGTCGAGT-G-TAAG-TCACTTG   [384]
Averticilliflorum    AATCCCGTGAATCATCGARTYTTTGAACGCAMGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGCGTCGTTT-ACTAAG-CCGCGTC   [388]
Aamericanum          AATCCCGTGAATCATCGAGTTTTTGAACGCAAGTTGCGTCTAAGGCCAATTATAGGTTTAAGGCATGCTTGTTTGGGCGTCGTTT-A-TAAGCCCACGTT   [389]
Aguatemalense        AATCCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGATCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTTGTGT-A-TAAG-TCATCAA   [387]
Apendens             AATCCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGATCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTAGTGT-A-TAAG-TCACCAA   [387]
Apusillum            AATTCCGCGAATCATTGAGTTTTTGAACGCAAGTTGCGCCCAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-CCATCTA   [389]
Abicarinatum         AATTCMGYGAATCATCGAATCTTTGAACGCACATTGCGCCTRAGRCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCATCTA   [386]
Adouglasii           AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGCGT-A-TAAG-TCAACTA   [382]
Adivaricatum         AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGACCAATTATAGGTT-AGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-CCAACTA   [386]
Adurangense          AATTCCGCGAATCATCAAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCAACTA   [387]
Avagcrypt            AATTCCGCGAATCATCAAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCAACTA   [388]
Avagvag              AATTCCGTGAATCATCAAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCAACTA   [387]
Ahawksworthii        AATTCCGTGAATCATCAAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCAACTA   [388]
Aglobosum            AATTCC?C?AATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGACCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TATG-TCAACTA   [385]
Aaureum              AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGACCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCAACTA   [385]
Anigrum              AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCAACTA   [386]
Agillii              AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCAACTA   [386]
Arubrum              AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGACCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTTT-A-YAA--TCAACTA   [385]
Astrictum            AATTCCGCGAATCATCAAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TA-G-TCAACTA   [386]
Aabietinummag        AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAATTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TAAG-TCAACTA   [388]
Aapachecum           AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAGTTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TGAG-ACAACTA   [387]
Acampylopodum        AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAGTTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TGAG-ACAACTA   [387]
Amicrocarpum         AATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCTAAGGCCAGTTATAGGTTTAGGGCATGCTTGCTTGGGTGTCGTGT-A-TGAG-ACAACTA   [388]

[                             410       420       430       440       450       460       470       480       490       500]
[                             .         .         .         .         .         .         .         .         .         .]

Aoxycedri            CAAA-CTCATTCTTTCACCACAT-ATGAATGTTTGTGGTTGGTTAGTTA-ATCGTTACATGGAGTCACTGTTTGTGGGTGTTGACCTCCCACTCACTAGC   [482]
Aabietis_rel         CAAA-CTCATTCTTTCACCACAT-ATGAATGTTTGTGGTTGGTTAGTTA-ATCGTTACATGGAGTCACTGTTTGTGGGTGTTGACCTCCCACTCACTAGC   [481]
Averticilliflorum    AATATCTTTTTC-AAGATATATTGATGGATGG--GTATTTGATTGTGGATATTGTTCTTTCGT-TCACT-AGATTGTGTGCGGTTGGATGAAATATTATT   [483]
Aamericanum          AATA-TTKTTTCCAAAATATATCGATAGACGGATGTATTTGGTTGTGGATATTGTTCTTTCGT-TCACT-AGATTGTGTGCGGTTGGATGAAAATATATT   [486]
Aguatemalense        AATA--TTTTTCCAAGACATTGTGACAGATGGATATATTTGGTTATGTGCGTTGTCTTCTCGT-TCACGTAGCTTGTGTACGATTGGATAAAATATTAGT   [484]
Apendens             AATA-TTTTTTCCAAGACATAGTGATGGATGGATGTATTTGGTTAT-TGCGTTGTCTTCTCGT-ACACCCA-CTTCTGTACGATTGGATAAAATATTAGT   [483]
Apusillum            AATATTTTTTTCCAGGACTTACTGATGGATGGACTTATTTGGTTGTGTGCGTTGTCCTCTCGT-TCACTTAGATTGTGTTGGATTGGATGAAATACTAGC   [488]
Abicarinatum         AATATTTTTTTTCAGGATTTATTGATGGATGGACTTATTTGGTTGTGCGTGCTGTCCTCTCAT-TCACTTGACCCGTGTTTGATTGGATGAAATATTAGC   [485]
Adouglasii           AATA-TTTTTTCCAAGATTTACTGATGGATGGACTAATTTGGTTGTGTGCATTGTCCTCTCGT-TCGCCTAGCTTGTGTTCGATTGGATGAAATTCTAGC   [480]
Adivaricatum         AATATCTTTTTCCAAGATTTATTGATGGATGGACTTATTTGGTTGTGTGCGCTGTCCTCTCGT-TCACTTGGTTTGTGCGCGGTTGGATGAAATATTAGC   [485]
Adurangense          AATG-TTTTATCCAAGATTTATTGATGGATGGACTTATTTGGTTGTGCGTGTTGTTCTCTCGT-TCACTAAGCTTGTGTTCGGTTGGATGAAATATTAGT   [485]
Avagcrypt            AATA-TTTTATCCAAGATTTATTGATGGATGGAGTTATTTGGTTGTACGTGTTGTTCTCTCGT-TCACTAAGCTTGTGTTCGGTTGGATGAAATATTAGT   [486]
Avagvag              AATA-TTTTATCCAAGATTTATTGATGGATGGACTTATTTGGTTGTGCGTGTTGTTCTCTCGT-TCACTTAGCTTGTGTTCGGTTGGATGAAATATTAGC   [485]
Ahawksworthii        AATA-TTTTATCCAAGATTTATTGATGGGTGGACTTATTTGGTTGTGCGTGTTGTTCTCTCGT-TCACTTAGCTTGTGTTCGGTTGGATGAAATATTAGC   [486]
Aglobosum            AATA-TATTTTC?AAAATTTATTGATGGATGGATTTATTTGGTTGTGTGCGTTGTCCTCTCGT-TCACTTAGCTTGTGTCCGGTTGGATGAAAGATTAGG   [483]
Aaureum              AATA-TATTTTCCAAAATTTATTG-TGGATGGATTTATTTGGTTGTGTGCGTTGTCCTCTCGT-TCACTTAGCTTGTGTCCGGTTGGATGAAAGATTATG   [482]
Anigrum              AATA-TTTTTTCCAAGATTTATCGATGGATGGACTTATTTGGTTGTGCGCATTGTCCTCTCGT-TCACTTAGCATGTGTTCGATTGGATGAAATCCTAGC   [484]
Agillii              AATA-TTTTTTCCAAGATTTATCGATGGATGGACTTATTTGGTTGTGCGCATTGTCCTCTCGT-TCACATARCATGTGTTCGATTGGATGAAATCCTAGC   [484]
Arubrum              AATA-TTTTTTCCAAGATTTATCGATTGATGGATTTATTTGGTTGTGCGCATTGTCTTCTCGA-TCACTTAGCGTGTGTTCGATTGGATGAAATGTTAGC   [483]
Astrictum            AATA-TTTTTTCCAAGATTTATTGATGGATGGACTTATTTGGTTGTACGCGTTGTCCTCTCGT-TCGCTTAGATTGGGTTCGGTTGGATGAAATATTAGC   [484]
Aabietinummag        AATA-TTTTTTCCATGATCTACTGATTGATTGACTTATTTGGTTGTGCTTCTTGTCCTCTCGT-TCACTTAGACTGTGTTCGGTTGGATGAAATATTAGA   [486]
Aapachecum           AATA-TTTTTTCCATGATCTACTGATTGATGGACTTATTTGGTTGTGCTTCTTGTCCTCTCGT-TCACTTAGACTGTGTTCGGTTGGATGAAATATTAGA   [485]
Acampylopodum        AATA-TTTTTTCCATGATCTACTGATGGATTGACTTATTTGGTTGTGCTTCTTGTCCTCTCGT-TCACTTAGACTGTGTTCGGTTGGATGAAATATTAGA   [485]
Amicrocarpum         AATA-TTTTTTCCATGATCTACTGATTGATGGACTTATTTGGTTGTGCTTCTTGTCCTCTCGT-TCACTTAGACTGTGTTCGGTTGGATGAAATATTAGA   [486]

[                             510       520       530       540       550       560       570       580       590       600]
[                             .         .         .         .         .         .         .         .         .         .]

Aoxycedri            TTTTGTGTGGTTGGT-TTAAATTTAATATCTTCGGTGTCATGTTTCTTGATATGTTTCGGTTAGCATTCGGAATTATTGTCATCATTGAAAGACTAAGGT   [581]
Aabietis_rel         TTTTGTGTGGTTGGT-TTAAATTTAATATCTTCGGTGTCATGTTTCTTGATATGTTTCGGTTAGCATTCGGAATTATTGTCATCATTGAAAGACTAAGGT   [580]
Averticilliflorum    GTATTTGATGCCAAA-TGTCTTACATG-TTTTGGTTAACATTGTATGATATTAATGTTATCGGGTAAAGCTAAAA--TCCAAATAGAATTTCAATCTCAT   [579]
Aamericanum          GTATTTGATACCAAA-TGTCTTACATG-TTTTGGTTAACATTGTATGATATTAATGTTATCAGGTAAGATAGAAA--GCCAAATAGAATATCAATCTTAT   [582]
Aguatemalense        GTTCTTGCCATCAAA-TGCCTTACATG-CTTTGGTTAATATTGTATGGTATTAATATTGTCAAGTTATAACTAAAATGCCAA-TAGATTGTCGGTCTCAT   [581]
Apendens             GTCCTTGCMATCAAA-TGCCTTACGTG-TTTTGGTTAACATTGTATGGTATCAATATTGTCAAGTTATAATTAAAAGGCCAAACAGATTGTCGGTCTTAT   [581]
Apusillum            ATCCTCGGCATTAAA-TGCCTTACATG-TTTTGGTTAACATTGTATGGTATTAATGTTATCAAGTTAAAACTAAA-GGCCAAATAGAACCTCGATCTTAT   [585]
Abicarinatum         ATCATTGGCATTAAA-TGCCTTACATG-TTTTGGTTAACATTGTATGGTACTAATGTTGCCAAGTCAAAACTAAA-GGCCAAACGGAATCTCGATCTTAT   [582]
Adouglasii           ATCCTTGGCATAAAA-TGCCTTACATG-TTTTGGTTAACATTGTATGGTATTAACGTTGTCAAGTTAAAACTGAA-GCTCAAATAAAATGCCGATCTCAT   [577]
Adivaricatum         ATCCTTGGCATCCTA-TGGCTTACATG-TTTTGGTTAACATTGTATGGTATTAACGTTGTCAAGTTTAGACTGGA-GGCCGAACAGAATGCCGATCTTAT   [582]
Adurangense          ATCCTTGGCATAAAA-TGCCTTACATGTTTTTGGTCAACATTGTATGGTATTAATGTTGTCAAGTTAAAACTAAA-GGCCAAACAGAATGCCGATCTTAT   [583]
Avagcrypt            ATCCTTGGCATAAAA-TGCCTTACATG-TTTTGGTCAACATTGTATGGTATTAATGTTGTCAAGTTAAAACTAAA-GGCCAAACAGAATGCCGATCTTAT   [583]
Avagvag              ATCCTTGGCATCAAA-TGCCTTACATG-TTTTGGTCAACATTGTATGGTATTGATGTTGTCAAGTTAAAACTGAAAGGCCAAACAGAATGCCGATCATAT   [583]
Ahawksworthii        ATCCTTG-CATCAAA-TGCCTTACATG-TTTTGGTCAACATTGTATGGTATTAATGTTGTCAAGTTAAAACTAAA-GGCCAAACAGAATGCCGATCTTAT   [582]
Aglobosum            ATCCTTGGCATCAAA-TGCCTTACATG-TTTTGGTTAACATTGTATGGTAATAATGTTGTCAAGTTAAAACTAAA-GGCCAAATAGAACGCCGATCTTAT   [580]
Aaureum              ATCCTTGGCATCAAA-TGCCTTACATG-TTTTGGTTAACATTGTATGGTATTAATGTTGTCAAGTTAAAACTAAA-GGCCAAATAGAACGCCGATCTTAT   [579]
Anigrum              ATCCT-GGCATCAAA-TGCCTTACATG-TTTTGGTTAACATTGTGTGGTATTGACGTTGTCAAGATAAAACTAGA-GGCCAAATAAAATGTCGATCATAT   [580]
Agillii              ATCCT-GGCATCAAA-TGCCTTACATG-TTTTGGTTAACATTGTGTGGTGTTGACGTTGTCAAGATAAAACTAGA-GGCCAAATAAAATGTCGATCATAT   [580]
Arubrum              ATCCT-GGCATCAAA-TGCCTTACATG-TTTTGGTTAACATTGTATGGTATTGACGTTGTCAAATTAGAACTAGA-GTCCAAATACAATGTCGATCTTAT   [579]
Astrictum            ATCCTTG-CATCAAAATGCCTTACATG-TTTTGGTGAACATTGCATGGTATTAATGTTGTCAAGTTAAAAGTAAA-GACCAAATTGAATGTCGATCTTAT   [581]
Aabietinummag        ATCCTTGGCATCGAA-TGTCTTGCATGTTTTTGGTTAACATTGTATGATATTAACGCTGTCTAGTTAAAATTGAA-TGCCAAACAGAATGCCGATCTCAT   [584]
Aapachecum           ATCCTTGGCATCGAA-TGTCTTGCATG-TTTTGGTTAACATTGTATGATATTAACGCTGTCTAGTTAAAATTGAA-TGCCAAACAGAATGCCGATCTCAT   [582]
Acampylopodum        ATCCTTGGCATCGAA-TGTCTTGCATG-TTTTGGTTAACATTGTATGATATTAACGCTGTCTAGTTAAAATTGAA-TGCCAAACAGAATGCCGATCTCAT   [582]
Amicrocarpum         ATCCTTGGCATCGAA-TGTCTTGCATGTTTTTGGTTAACATTGTATGATATTAACGCTGTCTAGTTAAAATTGAA-TGCCAAACAGAATGCCGATCTCAT   [584]

[                        ]
[                        ]

Aoxycedri            G?AT   [585]
Aabietis_rel         G?AT   [584]
Averticilliflorum    T-CT   [582]
Aamericanum          T-CT   [585]
Aguatemalense        C-CT   [584]
Apendens             C-CT   [584]
Apusillum            T-CT   [588]
Abicarinatum         T--T   [584]
Adouglasii           T-CT   [580]
Adivaricatum         T-CT   [585]
Adurangense          T-AT   [586]
Avagcrypt            T-AT   [586]
Avagvag              T-AT   [586]
Ahawksworthii        T-AT   [585]
Aglobosum            T-CT   [583]
Aaureum              T-CT   [582]
Anigrum              T-CT   [583]
Agillii              T-CT   [583]
Arubrum              T-CT   [582]
Astrictum            T-AT   [584]
Aabietinummag        T-CT   [587]
Aapachecum           T-CT   [585]
Acampylopodum        T-CT   [585]
Amicrocarpum         T-CT   [587]
;
END;