#NEXUS 
[Phoradendron alignment of nuclear ITS and 26S rDNA sequences]
[From V. E. T. M. Ashworth, Phylogenetic Relationships in Phoradendreae (Viscaceae) inferred from DNA sequence data.]
[Dissertation submitted to the Claremont Graduate University, Claremont, CA, 1999]
BEGIN DATA;
DIMENSIONS  NTAX=45 NCHAR=1602;
FORMAT MISSING=? GAP=-  INTERLEAVE  DATATYPE=DNA ;
OPTIONS  MSTAXA=UNCERTAIN;
[Note: the D2 region contains the D2 domain; the D8 region contains the D8 domain; the domain boundaries are delimited based on Kuzoff et al. 1998]
[Note: startpoints and endpoints of subregions are annotated by an * and ^, respectively]
[ITS1: first base of datamatrix = start of ITS1, ends at 291]
[5.8S = 292 (TGAATGAC...) to 460 (...TCATTC)]
[ITS2 = 461 (ATTG...) to 813]
[D2 region: 814-1195; start = TTGCAGCCCAAA... , end = ...ATTCGACC]
[D2 domain: 955-1192; start = GAATGGGGGT... , end = ...CCCCATTCG  (3 bp short of 5' end of D2 region]
[D8 region: 1196-1602; start = AGCTGGAACGGCAC..., end = ...GACTGTTTAATTAAAA] 
[D8 domain: 1404-1550; start = TTGGGCACGGGGG..., end = ...TCGGGCATCGAA]

MATRIX
[                                      10        20        30        40        50        60]
[                                      .         .         .         .         .         .]
P._capitellatum               TCGCTGCCCCAAAACA--GGTGTTCAGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._juniperinum                TCGGTGCCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._juniperinum_libocedri      TCGGTGCCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._bolleanum_densum           TCGCTGCCCCAAAATA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAT   [55]
P._bolleanum_pauciflorum      TCGCTGCCCCAAAATA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAT   [55]
P._minutifolium               TCACTGCCCCAAAAAA--GGTGTTCGGAGAACATGTTGTACCATT--GATTGA-GGTGAT   [55]
P._bolleanum                  TCGCTGCCCCAAAAAA--GGTGTTCGGAGAACATGTTGTACCATT--GATTGA-GGTGAT   [55]
P._tomentosum_macrophyllum    TCGCTGTCCCAAAATA--GGCGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._tomentosumM                TCGCGGTCCCAAAATA--GGCGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAG   [55]
P._serotinum                  TCGCTGTCCCAAAATA--GGCGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._tomentosumTX               TCGCGGTCCCAAAATA--GGCGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAG   [55]
P._villosum                   TCGGTGTCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._villosum_coryae            TCGGTGTCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._scaberrimum                TCGGTGTCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._galeottii                  TCGTTGTCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCAAT--GATTGA-GGTGAA   [55]
P._longifolium                TCGTTGTCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCAGT--GATTGA-GGTGAA   [55]
P._robinsonii                 TCGCTGTCCCAAAACA--GGTGTTCGGAGAACATGTTGTACCATC--GATTGA-GGTGAA   [55]
P._rhipsalinum                TTGTTGTCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._brachystachyum             TCGCTGTCCCAAAACA--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
P._velutinumSLP               TCGCTGTCCCAAAACA--GGTGTGTGGAGAACATGTTGAACCATT--GTTAGA-GGTGAA   [55]
P._velutinumM                 TCGCTGTCCCAAAACA--GGTGTTTGGAGAACATGTTGAACCATT--GTTAGA-GGTGAA   [55]
P._forestierae                TGGCTGTCCCAAAATG--GGTGTTCGGGGAACATGTTGAGACATTATGATTGA-GGTGAG   [57]
P._brevifolium                TCGCTGTCCCAAAATG--GGTGTTCGGAGAATGTGTTAAACCATT--GATTGA-GGTGAA   [55]
P._reichenbachianum           TAGCTGTCCCAAAATG--GGTGTTCGGAGAACATGTTGAACCATT--GATTGA-GGTGAA   [55]
D._guatemalensis              TCGCTAACCCAAAATG--GGTGTTCGGAGAACATGTTGAGCAATT--CCTTGA-GGTGAA   [55]
P._vernicosum                 TGGATGCCCCAGAATG--AGTGTTCGGAGAACATGTTGAACCAAT--CATTGAAGGTGAG   [56]
P._californicum               TCGATGACTCAAATTGTGGGTGTTCAGAGAACATGTTGGTCCATG--CATTAA-GGTGAA   [57]
P._heydeanum                  TCGATGTCCTCAAATG--GGTGATCGGGGAACATGTTGGAGCGTC--TATAGA-GGTGAA   [55]
P._tamaulipense               TTGATGTCTCGTAATG--TGTGCTCGGGGAACTTGTTGGACCATT--TACAGA-GGTGAA   [55]
P._trinervium                 TTGATGTCTCGTAATG--TGTGCTCGTGGAACTTGTTGGACCATT--TATAGA-GGTGAA   [55]
P._carneum                    TCGATGTCCCAAAATG--GGTGATCGGGGAACATGTTGGACCATT--CATAGA-GGTGAG   [55]
P._robustissimum              TTGATGTCCCAGAATG--GGTGATCGGGGAACATGTCGGACCATT--CATGGA-GGTGAA   [55]
P._nervosum                   TTGATGTCCCAAAATG--GGTGAACGGTGAACATGTCGGTCCATT--CATAGA-GGTGAA   [55]
P._cf._tonduzii               TTGATGTCCCAAAATG--GGTGAACGGTGAACATGTCGGACCATT--CATAGA-GGTGAA   [55]
P._sulfuratum                 TCGATGCCTRAAAATG--GGTGATCTGAGAACATGT--------------------TGAA   [38]
D._opuntioides                TCGATTCCATAAATTG--GGTGAACGGAGAACATGT--------------------TGAA   [38]
D._domingensis                ------------------------------------------------------------   [0]
D._clavata                    TCGATGCCTTAAAATG--GGTGACCAGAGAACATGT--------------------TGAA   [38]
D._costaricensis              TCGATGCCTTAAA-TG--GGTGACCGGAGAACATGT--------------------TGAA   [37]
D._squamigera                 TCGATGCCTTAAAATG--GGTGACCCGAGAACATGT--------------------TGAA   [38]
P._crassifolium               TCGATGCGTTAAAATG--GGTGATCAGAGAACATGT--------------------TGAA   [38]
P._piperoides                 TCGATGCGTTAAAATG--GGTGATCAGAGAACATGT--------------------TGAA   [38]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      70        80        90        100       110       120]
[                                      .         .         .         .         .         .]
P._capitellatum               CAA------GGTG----GAGTT--------------------------------------   [67]
P._juniperinum                CAC------GGTG----GAGTTGT--CCGG--CTGA---CGTATGATTTC--ATTACAT-   [95]
P._juniperinum_libocedri      CAA------GGTG----GAGTTGT--CCGG--CTGA---CGTATGATTTC--ATTACAT-   [95]
P._bolleanum_densum           CAACAA---GGTT----GAGTTGTGTCCGG--CTGA---CGTATGATTTC--ATGACAT-   [100]
P._bolleanum_pauciflorum      CAACAA---GGTT----GAGTTGTGTACGG--CTGA---CGTATGATTTC--ATGACAT-   [100]
P._minutifolium               AAACAA---GGTG----GAGTTGT--CCGG--CTAA---CGTATGATTTC--ATGACAT-   [98]
P._bolleanum                  GAACAA---GGTG----GAGTTGT--CCGG--CTAA---CGTATGATTTC--ATGACAT-   [98]
P._tomentosum_macrophyllum    CAA------GGTG----GAGTTCT--CCGG--CCGG---CGCATGGTTTT--TTGGCATG   [96]
P._tomentosumM                CAG------GGTG----GAGTTCT--CCGG--CCGG---CGTATGGTTTT--TTGACATG   [96]
P._serotinum                  CAA------GGTG----GAGTTCT--CCGG--CCGG---CGTAYGGTTTT--TTGACATG   [96]
P._tomentosumTX               CAG------GGTG----GAGTTCT--CCGG--CCGG---CGTATGGTTTT--TTGACATG   [96]
P._villosum                   CAA------GGTG----GAGTTCT--CCGG--CCGA---CGTATGATTTC--ATGACAT-   [95]
P._villosum_coryae            CTA------GGTG----GAGTTCT--CCGG--CCGA---CGTATGATTTC--ATGACAT-   [95]
P._scaberrimum                CTA------GGTG----GAGTTCT--CTGG--CCGA---CGTATGATTTC--ATGACAT-   [95]
P._galeottii                  CAA------GGTG----GAGTTCT--TCGG--TCGA---CGTATGGTTTC--ATGACAT-   [95]
P._longifolium                CAA------GGTG----GAGTTCT--TCGG--CCGA---TGTATGGTTTC--ATGACAT-   [95]
P._robinsonii                 CAA------GGTT----GAGTTCC--TCGG-GCCGA---CGTATGGTTTT-TTTTACAC-   [97]
P._rhipsalinum                TGA------GGTG----GATTTCT--TCGG--GTGA---CGTATGATTTT--ATGACATG   [96]
P._brachystachyum             CGA------GGTG----GATTTCT--CCGG--GCGA---CGTATGATTTT--ATGACATG   [96]
P._velutinumSLP               CRA------GGTG----GASTTCT--CTGG--CCGG---CGAATGGTTTG--TTGACAT-   [95]
P._velutinumM                 CAA------GGTG----GAGTTCT--CTGG--CCGG---CGAATGGTTTT--TTGACAT-   [95]
P._forestierae                CGA------TGTG----GTTTTCT--CCGG--TCGA---CATATGATTTT--ATGACAT-   [97]
P._brevifolium                CAG------GGTG----GTGTTCT--CCAWA-GCGG--ACTTATGGTTTT--ATGACAT-   [97]
P._reichenbachianum           CAA------GGTG----GTGTTCT--CCGG--YCGA---CGCATGATTTT--ATGACAT-   [95]
D._guatemalensis              CAA------CGAG----GAGTGCT--CCAG--CCAG---CGTATGATTTT--ATGACAT-   [95]
P._vernicosum                 CAA------CGTG----AAGGGCT--CCAG--TTGA---TGTATGATTTT--ATGACAT-   [96]
P._californicum               CAA------CATG-----TTGGCC--TAAT---CGA---CATGTGATTTTT-GTGGCAT-   [96]
P._heydeanum                  CAG---CG-CAGGG--TGGGTGCT--TCAG--TCGAGA-TCAATGATCCT--TTGACAT-   [101]
P._tamaulipense               CAG-----ACACA----GTTTGCT--TTCG--GCGA---GATATGATCCT--ACGAAAT-   [96]
P._trinervium                 CAA-----ACACG----GTTTGCT--TTCG--GCGA---GGCATGGTCCT--ATGAAAT-   [96]
P._carneum                    CAA------CACT----GGGTGCT--TTAG--TCGA---GATATGATCCT--ATGACAT-   [95]
P._robustissimum              CAA------CACA----GGGTGCT--TCAG--TTGA---GCCATGATCAT--ATGACAT-   [95]
P._nervosum                   CAA------CACT----GGGTGCT--TCAT--TTGA---GATATGATCCT--ATGACAT-   [95]
P._cf._tonduzii               CAA------CACT----GGGTGCT--TCAT--TCGA---GATATGATCCT--ATGACAT-   [95]
P._sulfuratum                 TAA------CGTG----GGGTGCT--CAAA--GCAA---CACATCCTCTT--ATGGCAT-   [78]
D._opuntioides                CAT------CACG----GGGTGCT--TAAG--TCCA---CACATGCTCTT--ATGACAT-   [78]
D._domingensis                ------------------------------------------------------------   [0]
D._clavata                    CAA------CACG-GG-GAGTGCT--TATG--ACAA---CACATGATCTT--ACGACAT-   [80]
D._costaricensis              CAA------CACG----GAGTGCT--TATG--ACAA---CACATGATCTG--ACGACTT-   [77]
D._squamigera                 CAA------CACG----GAGTGCT--TATG--ACAA---CACATGATCTT--ACGACAT-   [78]
P._crassifolium               CAA------CACG----AAGCGCT--TAAC--ATAA---CACATGATCTT--ACGGCAT-   [78]
P._piperoides                 CAA------CACG----AAGCGCT--TAAC--ATAA---CACATGATCTT--ACGGCAT-   [78]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      130       140       150       160       170       180]
[                                      .         .         .         .         .         .]
P._capitellatum               --------------------GGTGA-ACCTCATG-TGCG--TGTTGTTTTTCTA-ATAGG   [102]
P._juniperinum                ---GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGCG--TGTTGTTAACCTA-ATAGG   [147]
P._juniperinum_libocedri      ---GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGCG--TGTTGTTAACCTA-ATAGG   [147]
P._bolleanum_densum           ---GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGCG--TGTTGTTAACCTA-ATAGG   [152]
P._bolleanum_pauciflorum      ---GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGTG--TGTTGTTAACCTA-ATAGG   [152]
P._minutifolium               ---GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGTG--TGTTGTTAACCTA-ATAGG   [150]
P._bolleanum                  ---GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGTG--TGTTGTTAACCTA-ATAGG   [150]
P._tomentosum_macrophyllum    T--GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGCG--TTTTGTTAACCTA-ATAGG   [149]
P._tomentosumM                T--GAGTTGGTTGGTGCTTTGGTGA-ACCTCATG-CGCG--TTTTGTTAACCTA-ATAGG   [149]
P._serotinum                  T--GAGTTGGTTGGTGCTTTGGTGA-CCCTCATG-TGCG--TTTTGTTAACCTA-ATAGG   [149]
P._tomentosumTX               T--GAGTTGGTTGGTGCTTTGGTGA-ACCTCATG-CGCG--TTTTGTTAACCTA-ATAGG   [149]
P._villosum                   ---GGCTTCGTTGGTGCTTTGGTGA-ACCTCATA-TGCG--TGTTGTGAACCTA-ATAGG   [147]
P._villosum_coryae            ---GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGYG--TGTTGTTAACCTA-ATAGG   [147]
P._scaberrimum                ---GGGTTGGTTGGTGCTTTGGTGA-ACCTCATG-TGCG--TGTTGTTAACCTA-ATAGG   [147]
P._galeottii                  ---GGGTTGGTTGGTGCTTAGGTGA-ACCTCATG-TGCG--TGTTGTTAACCTA-ATAGG   [147]
P._longifolium                ---GGGTTGGTTGGTGCTTAGGTGA-ACCTCATG-TGCG--TGTTGTTAACCTA-ATAGG   [147]
P._robinsonii                 ---GTGTTGGTCGGGGCATTGGGGA-ACCTCATG-TGCG--CCTCGTTAACCTA-ATAGG   [149]
P._rhipsalinum                TGTTGGTTTGTTGGTGCTTTTGTGA-CCCTCATG-GTGG------GTTAACCTA-ATCGG   [147]
P._brachystachyum             TGTTGGTTGGTTGGTGCTTTTGTGA-ACCTCATG-CGCG-----TGTTAACCTA-ATCGG   [148]
P._velutinumSLP               ---GTGTCGGTTGGTGCTTTGGTGA-GCCTCATG-TGCG--TRTTGTTAACCTA-AKAGG   [147]
P._velutinumM                 ---GTGTCGGTTGGTGCTTTGGTGA-GCCTCATG-TGCG--TTTTGTTAACCTA-ATAGG   [147]
P._forestierae                ---GAGTTGGTTGGTGATTTGGTGA-ACCTCGTG-TGCGCGTGTTGTTAACTTG-GGAGG   [151]
P._brevifolium                ---GAGTTGGTTGGTGCTTTGGTGA-ACCTCCTG-TATG-----TGTGAACTTA-GTAGG   [146]
P._reichenbachianum           ---GAGTTGGTTGGTGCTTTTGTGA-ACCTCGTG-TGCG--TGTTGTTAACTTA-GTAGG   [147]
D._guatemalensis              ---GCGTTGGTTAGCACTTCGGTGC-ACCTCATG-TGCG--TGCTGTTAACTTT-ATAGG   [147]
P._vernicosum                 ---TGGCTGGTTGGCACTTCGGTGCCACCTTAGT-TCCG--TGTTGCTCACTTAAATAGG   [150]
P._californicum               ---GTGTCAGTTTGCACTTTTGTGC-ACCACGTG-TTTG--TTTACTCAACATA-ATTGG   [148]
P._heydeanum                  ---TTGTCGGTTAGCACTGGGGTCC-ACCTCAAG-TGTG----TAATTAAGTTA-GTTG-   [150]
P._tamaulipense               ---TTGTCTGCTAGCAGTCTGGTCC-ACCTCAAT-CGGG----AAATTAAGTTA-AGTG-   [145]
P._trinervium                 ---TTGTCGGCTAGCAGTGGGGTCC-ACCTCAAT-TGAG----AAATTAAGCTA-CGTG-   [145]
P._carneum                    ---GTGTTTGTTAGCGCTGTGGCCC-ACCTCAAG-TGAG----TAATTAAGTTT-GTTG-   [144]
P._robustissimum              --------GGT-AGCGCTGGGGTCC-ACCCCAAG-TGAG----TAATTAAGTCA-GGTG-   [138]
P._nervosum                   ---GTGTCGGTTAGCACTGGGGTCC-ACCTTAAG-TGAG----TAATCAA-----GTTG-   [140]
P._cf._tonduzii               ---GTGTTGGTTAGCACTGGGGTCC-ACCTTAAG-TGAG----TAATCAA-----GTTG-   [140]
P._sulfuratum                 ---GTGCTGGTTTACACTCCTGTGC-ACCTGAGG-CGTG----CAATTTACTTG-ATCGG   [128]
D._opuntioides                ---GCGTCGGTTAACACTTCCGTGC-ACCTCAGG-TGCG----TAACTAACTTA-ATCGG   [128]
D._domingensis                ------------------------------------------------------------   [0]
D._clavata                    ---GCGTCGACTAACACTTYYGTGC-ACCTCAAG-TGCG----CAACTAACATA-ATTGG   [130]
D._costaricensis              ---GCGTCGATTAACACTTCCGTGC-ACCTCAGG-TGCG----CAACTAACATA-ATCGG   [127]
D._squamigera                 ---GCGTCGATTAACACTTTGCTGC-ACCTCAGGGTGCG----CACCTAACATA-ATTGG   [129]
P._crassifolium               ---GCGTCGGTTAACGCTTCGGTGC-ACCTCAGG-TGCG----CAAATAACCTA-ATCGG   [128]
P._piperoides                 ---GCGTCGGTTAACGCTTCGGTGC-ACCTCAGG-TGCG----CAAATAACCTA-ATCGG   [128]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      190       200       210       220       230       240]
[                                      .         .         .         .         .         .]
P._capitellatum               CACGGAAT-GTGCCAAG--GAATGACGGT--CAAA-----GGAA-CCTT--CCCT--GTT   [147]
P._juniperinum                CACGGAAT-GTGCCAAG--GAATGACGGT--CAAA-----GGAA-CCTT--CCCC--GTG   [192]
P._juniperinum_libocedri      CACGGAAT-GTGCCAAG--GAATGACGGT--CAAA-----GGAA-CCTT--CCCC--GTG   [192]
P._bolleanum_densum           CACGGAAT-GTGCCAAG--GAATGACGGT--CAAA-----GGAA-CCTT--CCCT--GTG   [197]
P._bolleanum_pauciflorum      CACGGAAT-GTGCCAAG--GAATGACGGT--CAAA-----GGAA-CCTT--CCCT--GTG   [197]
P._minutifolium               CACGGAAT-GTGCCAAG--GAATTACGGT--CAAA-----GGAA-CCTT--CCCG--GTG   [195]
P._bolleanum                  CACGGAAT-GTGCCAAG--GAATTGCGGT--TAAA-----GGAA-CCTT--CCCC--GTG   [195]
P._tomentosum_macrophyllum    CACGGAAT-GTGCCAAG--GAATGATGGT--CGAAGTGG-AGAA-CCTT--CCCC--ATG   [198]
P._tomentosumM                CACGGAAT-GTGCCAAG--GAATGATGGT--GAAAGTGG-AGAT-CCTT--CCCC--ATG   [198]
P._serotinum                  CACGGAAT-GTGCCAAG--GAATGATGGT--CAAAGTGG-AGAA-CCTT--CCCC--ATG   [198]
P._tomentosumTX               CACGGAAT-GTGCCAAG--GAATGATGGT--GAAAGTGG-AGAT-CCTT--CCCC--ATG   [198]
P._villosum                   CACGGAAT-GTGCCAAG--GAATGATGGT--CAAA-----GGAA-CCTT--CCCC--GCG   [192]
P._villosum_coryae            CACGGAAT-GTGCCAAG--GAATGACGGT--CAAA-----GGAA-CCTT--CCCC--GTG   [192]
P._scaberrimum                CACGGAAT-GTGCCAAG--GAATGACGGT--CAAA-----GGAA-CCTT--CCCC--GTG   [192]
P._galeottii                  CACGGACT-GTGCCAAG--GAATGATGGT--AAAA-----GGAA-CCTT--CCCG--ATT   [192]
P._longifolium                CACGGACT-GTGCCAAG--GAATGACGGT--AAAA-----GGAA-CCTT--CCCG--ATT   [192]
P._robinsonii                 CACGGAAT-GTGCCAAG--GAATGACGGT--CGAA-----GGAA-CCTT--CCAC--ATT   [194]
P._rhipsalinum                CACGGAAT-GTGCCAAG--GAATGATGGT--GAAA-----GGAA-CCTT--CCCC--AAG   [192]
P._brachystachyum             CACGGAAT-GTGCCAAG--G-ATGACGGT--GAAA-----GGAA-CCTT--CCCC--GAG   [192]
P._velutinumSLP               CACGGAAT-GTGCCAAG--GAATGATGGT--CAAA-----RGAA-CCTT--CCTC--ACK   [192]
P._velutinumM                 CACGGAAT-GTGCCAAG--GAATGATGGT--CAAA-----GGAA-CCTT--CCCC--ACG   [192]
P._forestierae                CACGGAAC-GTGCCAAG--GAATGATGGT--CGAA-----TGAA-CCTT--CCCC--ACG   [196]
P._brevifolium                CATGGAAT-GTGCTAAG--GAGTGACGCT--TGAA-----TGAAACCTT--CCCC--ACG   [192]
P._reichenbachianum           CACGGAAT-GTGCCAAG--GAATGATGGT--CGAA-----TGAA-CCTT--CCCC--ACG   [192]
D._guatemalensis              CACGGAAT-GTGCCAAG--GAAGGATGGT--TGAA-----GGAA-CCTT--CTCCGGATG   [194]
P._vernicosum                 CACGGAAT-GTGCCAAG--GAAGGATGGT--TGAT-----GGAA-CCTTTTCTGCGGAGG   [199]
P._californicum               CA-TGAATTGTGCCAAG--GAATGATGAT--CAAT-----GCTT-TTCA---TATTAATG   [194]
P._heydeanum                  CACTGAAT-GTGCGAAG--GAAACCTATT--CGAA-----GGAA-CCTT--TTTCCAT--   [195]
P._tamaulipense               CACGGAAT-GTGCTAAG--GAAAGCTATT--TGTA-----TGAA-CCTT--CTTCCAA--   [190]
P._trinervium                 CACGGAAT-GTGCTAAGGAGAAAGCTATT--TGAA-----GGGA-CCTT--CTTCCAA--   [192]
P._carneum                    CACGGAAT-GTGCTAAG--GAAAGCTATG--CGAA-----GGAA-CCTT---TTCCAG--   [188]
P._robustissimum              CAGGGAAT-GTGCTAAG--GAATGCTATATACGAA-----GAAA-CCTG---TTGCAA--   [184]
P._nervosum                   CACTGAAT-GTGCTAAG--GGAAGTTAGG--CGAA-----GTAA-CCTT---TTCCAA--   [184]
P._cf._tonduzii               CACTGAAT-GTGCTAAG--GCAAGCTAGG--CGAA-----GTAA-CCTT---TTCCAA--   [184]
P._sulfuratum                 CACGGAAT-GTGCTAAG--GAAAGCTGTA--CAAA-----GGAA-CCTT--CTCCTAACG   [175]
D._opuntioides                CACGGAAT-GTGCCAAG--GAAAGCTGTT--CAGC-----TGAA-CCTC--CTCCTAACG   [175]
D._domingensis                ------------------------------------------------------------   [0]
D._clavata                    CACGGGAT-GTGCTAAG--GAAAGCTGTT--CAAA-----GGAA-CCTC--CTCCTATTG   [177]
D._costaricensis              CACGGGAT-GTGCTAAG--GAAAGTTGTT--CAAA----GGGAA-CC-C--CTCCTAATG   [174]
D._squamigera                 CACGGGAT-GTGCTAAG--GAAAGCTGTT--CAAA-----GGAA-CCTC--CTCCTAATG   [176]
P._crassifolium               CACGGAAT-GTGCTAAG--GAAAGTTGAT--CGAA-----GGAA-CCTT--CTCCTAATG   [175]
P._piperoides                 CACGGAAT-GTGCTAAG--GAAAGTTGAT--CGAA-----GGAA-CCTT--CTCCTAATG   [175]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      250       260       270       280       290       300]
[                                      .         .         .         .         .         .]
P._capitellatum               CATGT-TCGAAACTTGT-TC-CGAGGGGGG-TTTCAAGCAGTAAA--AATCTGAATGACT   [201]
P._juniperinum                CATGT-TTGAAACTTGT-TC-GGAGGGGGG-TTTCAAGCATTAAA--CGTCTGAATGACT   [246]
P._juniperinum_libocedri      CATGT-TTGAAACTTGT-TC-GGAGGGGGG-TTTCAAGCATTAAA--CGTCTGAATGACT   [246]
P._bolleanum_densum           CATGT-TCGAAACTTGT-TC-GGATGGGGG-TTTCAAGCATTAGA--CATCTGAATGACT   [251]
P._bolleanum_pauciflorum      CATGT-TCGAAACTTGT-TC-GGATGGGGG-TTTCAAGCATTAGA--CATCTGAATGACT   [251]
P._minutifolium               CATGT-TCGAAACTTGT-TC-GCAGGGGGG-TTTCAATCATTAAA--CATCTGAATGACT   [249]
P._bolleanum                  CATGT-TCGAAACTTGT-TC-GGAGGGGGG-TTTCAATCATTAAA--CATCTGAATGACT   [249]
P._tomentosum_macrophyllum    CATGT-TAGTAACTTGT-TC-GGAGGGGGG-TTTCATGCGTTAAA--CATCTGAATGACT   [252]
P._tomentosumM                CATGT-TAGAAACTTGT-TC-GGAGGGGGG-TTTCATGCGTTAAA--CATCTGAATGACT   [252]
P._serotinum                  CATGT-TAGAAACTTGT-TC-GGAGGGGGG-TTTCATGCGTTAAA--CATCTGAATGACT   [252]
P._tomentosumTX               CATGT-TAGAAACTTGT-TC-GGAGGGGGG-TTTCATGCGTTAAA--CATCTGAATGACT   [252]
P._villosum                   CATGT-TTGAAACTTGTGTC-GGAGGGGGG-TTTCAAGTATTAAA--CATTGGAATGACT   [247]
P._villosum_coryae            CATGT-TTGAAACTTGTGTCTGSGGGGGGG-TTTCAAGCATTAAA--CATCGGAATGACT   [248]
P._scaberrimum                CATGT-TTGAAACTTGTGTCTGCGGGGGGG-TTTCAAGCATTATA--CATCCGAATGACT   [248]
P._galeottii                  CATGT-TTGAAACTTGTGTC-GGAGGGGGG-TTTCAAGCATTAGA--CATCTGAATGACT   [247]
P._longifolium                CATGT-TTGAAACTTGTGTC-GGAGGGGGG-TTTCAAGCATTAGA--GATTTGAATGACT   [247]
P._robinsonii                 AACGT-TCCAAACTTGT-TT-GGAGGGGGG-GTTCAAGCATTAAA--CATCTGAATGACT   [248]
P._rhipsalinum                CATGT-CTGAGACTTGT-TC-GGAGGGGTG-TCTCAAGCATTAAA--CATCTGAATGACT   [246]
P._brachystachyum             CATGT-CTGAAACTTGT-TC-GGAGGGGGG-TCTCAAGCGTTAAA--CATCTGAACGACT   [246]
P._velutinumSLP               CATGT-TCGATACTTGT-KC-GCGGGGGGG-TTTCCTGCATTGAA--CATCTGAATGACT   [246]
P._velutinumM                 CATGT-TCGAAACTTGT-TC-GCGGGGGGG-TTTCATGCATTGAA--CATCTGAATGACT   [246]
P._forestierae                CATGT-TCATAACTTGT-AT-GGAGGGGGG-TTTCTATCATTAAA--CATCTGAATGACC   [250]
P._brevifolium                CATGT-TCAAAACTTGT-TA-CGA--GGGG-TTTCAAGCATTAAA--CATCTCAACGACT   [244]
P._reichenbachianum           CATGG-TCAAAACTTGT-TT-GGAGGGGGG-TTTGAAGCATTAAA--TATCTGAATGACT   [246]
D._guatemalensis              CATGT-TCAAAACTTGT-TC-GGAGGGGTG-TTCCAAGCATTAAA--CATCGGAATGACT   [248]
P._vernicosum                 CATGT-TCCTAACATTT-TA-GAAGTGGGG-TTCCAAGCCTTGAA--CATATGAATGACT   [253]
P._californicum               CATGTGTCAA-ACATGT--A-TGAGTTGGT-TATTGAGCATTGAA--TGTTTGTATGACT   [247]
P._heydeanum                  CATGTATACATACAGGT-TG-GACGCTGGG-TACTTGGCATTAAA--CGTCAGTATGACT   [250]
P._tamaulipense               CATGTGTCCATGCATGT-TT-GAGGTGGGG-CACCAGGTGTCAAAA-CATCAGTATGACT   [246]
P._trinervium                 CATGTATCCATGCATGT-TT-GAGGTGGGG-CACCAGGTATCAAA--CATCGGTATGACT   [247]
P._carneum                    CATGTATCCGTACATGT-TG-GGCGTGTGG-TATCAAGCGTTAAA--CATCAGTATGACT   [243]
P._robustissimum              CGTGTATCCATACATGT-TA-GGCATGGGG-TATCAAGCGTTACA--CTTCAATATGACT   [239]
P._nervosum                   CATGTATCAACTCATGT-TA-GGGGTGGGG-TATCAAACGTTAAA--CATCAGTATGACT   [239]
P._cf._tonduzii               CATGTATCAACTCATGT-TA-GGGGTGGGG-TATCAAGCGTTATA--CATCAATATGACT   [239]
P._sulfuratum                 CGTGT-TCATAACATGT-TA-GCAATGGGGGTACTGAATGTTAAA-ACATCTAAATGACT   [231]
D._opuntioides                CATGT-TCATMACATGC-TG-GCAGCGGGG-TATCGAACGTTAAA--CATTTACATGACT   [229]
D._domingensis                ------------------------------------------------------------   [0]
D._clavata                    CATGT-TCACAACATGT-CA-GCGGCGGGG-TACCAAACATTAAA--CAGTTAAATGACT   [231]
D._costaricensis              CATGT-TCATAACATGT-CG-GCAGCGGGG-TACCAAATGTTAAA--CATCTAAATGACT   [228]
D._squamigera                 CATGT-TCATAACATGT-CA-GCTGCGGGG-TACCGAGCGTTAAG--CATCTAAATGACT   [230]
P._crassifolium               ------------CATGT-TA-GCAGTGAGG-TACCACACCTTAAA--CATCTAAATGACT   [218]
P._piperoides                 ------------CATGT-TA-GCAGTGAGG-TACCACACCTTAAA--CATCTAAATGACT   [218]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      310       320       330       340       350       360]
[                                      .         .         .         .         .         .]
P._capitellatum               CTCGACGACGGATATCTTGGYTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [261]
P._juniperinum                CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [306]
P._juniperinum_libocedri      CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [306]
P._bolleanum_densum           CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [311]
P._bolleanum_pauciflorum      CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [311]
P._minutifolium               CTCGACGACGGATATCTTDGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [309]
P._bolleanum                  CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [309]
P._tomentosum_macrophyllum    CTTGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [312]
P._tomentosumM                CTTGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [312]
P._serotinum                  CTTGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [312]
P._tomentosumTX               CTTGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [312]
P._villosum                   CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATATGTT   [307]
P._villosum_coryae            CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [308]
P._scaberrimum                CTCGACGACGGATATCTTGGCTCCTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [308]
P._galeottii                  CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [307]
P._longifolium                CTCGACGACGGATATCTTGGCTCTYGCATCGATGAAAAACGCAGCGAAATGCGATACGTT   [307]
P._robinsonii                 CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [308]
P._rhipsalinum                CTTGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGTGATATGTC   [306]
P._brachystachyum             CTTGGCGACGGATATCTTGGCTCTTGCATCGATGAAGGACGCAGCGAAATGCTATACGTT   [306]
P._velutinumSLP               CTCGACRACTGATATCTTGGCTCTAGCCTCCAAGAACAACGCCGCGAAATGCGATACGTG   [306]
P._velutinumM                 CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGGACGCAGAGAAATGCGATACGTT   [306]
P._forestierae                CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [310]
P._brevifolium                CTCGACGACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTG   [304]
P._reichenbachianum           CTCGACGATGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTT   [306]
D._guatemalensis              CTTGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTG   [308]
P._vernicosum                 CTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGTGATACGTG   [313]
P._californicum               CTTAACAACGGATATCTGGGCTCTTGTATCGATGAAGAACGTAGCGAAATGTGATACGTG   [307]
P._heydeanum                  CTTGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATATGTT   [310]
P._tamaulipense               CTTGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATATGTT   [306]
P._trinervium                 CTTGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATATGTT   [307]
P._carneum                    CTTGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATATGTT   [303]
P._robustissimum              CTTGACGATGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGAKATGTT   [299]
P._nervosum                   CTTGACAACGGATATCTTGGCTCTTGCATCGAT????????????GAAATGCGATATGTT   [299]
P._cf._tonduzii               CTTGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATATGTT   [299]
P._sulfuratum                 CTCGACAACGGATATCTTGGCTCTTGCA??????????????????AAATGCGATACGTG   [291]
D._opuntioides                CTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACG??ACGAAATGCGATACGTG   [289]
D._domingensis                ----------------------------------AGAGAAGTGCGGAAATGCGATACGTG   [26]
D._clavata                    CTCGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTG   [291]
D._costaricensis              CTCGACAACGGATATCTTGGCTCTGGC??????????????????GAAATGCGABACGTG   [288]
D._squamigera                 CTCGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACGTG   [290]
P._crassifolium               CTCGACAACGGATATCTTGGCTCTTGCATCGAT????????????GAAATGCGACACGTG   [278]
P._piperoides                 CTCGACAACGGATATCTTGGCTCTTGCATCGAT?????????AGCGAAATGCGATACGTG   [278]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      370       380       390       400       410       420]
[                                      .         .         .         .         .         .]
P._capitellatum               GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [321]
P._juniperinum                GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [366]
P._juniperinum_libocedri      GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [366]
P._bolleanum_densum           GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGTC   [371]
P._bolleanum_pauciflorum      GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGTC   [371]
P._minutifolium               GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [369]
P._bolleanum                  GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [369]
P._tomentosum_macrophyllum    GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [372]
P._tomentosumM                GTGTGAATTGCAGAATCCCGTGAACCATTGAATCTTTGAACGCAAGTTGCGCCCAATGCC   [372]
P._serotinum                  GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATTCC   [372]
P._tomentosumTX               GTGTGAATTGCAGAATCCCGTGAACCATTGAATCTTTGAACGCAAGTTGCGCCCAATGCC   [372]
P._villosum                   GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [367]
P._villosum_coryae            GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [368]
P._scaberrimum                GTGTGAATTGCAGAATCCCGTGAATCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [368]
P._galeottii                  GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [367]
P._longifolium                GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [367]
P._robinsonii                 GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [368]
P._rhipsalinum                GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCACGTTGCGCCCAATGCC   [366]
P._brachystachyum             GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [366]
P._velutinumSLP               GTGTGAATTGCAGAATCCCGTGAATCATCGAATCTTTGAACGCAAGTTGCGCCCAATGCT   [366]
P._velutinumM                 GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [366]
P._forestierae                GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [370]
P._brevifolium                GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCATGTTGCGCCCAATGCC   [364]
P._reichenbachianum           GTGTGAATTGCAGAATCCCGTGAACCATTGAATCTTTGAACGCAAGTTGCGCCCAATGCC   [366]
D._guatemalensis              GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [368]
P._vernicosum                 GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [373]
P._californicum               GTGTGAATTGCAGAATCTCGTGAACCATTGAATCTTTGAACGCAAGTTGTGCCCAATGCC   [367]
P._heydeanum                  ATGTGAATTGCAGAATCCTGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [370]
P._tamaulipense               ACGTGAATTGCAGAATCCTGTGAACCATCGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [366]
P._trinervium                 ATGTGAATTGCAGAATCCTGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [367]
P._carneum                    ATGTGAATTGCAGAATCCTGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [363]
P._robustissimum              ATGTGAATTGCAGAATCCTGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGACGCC   [359]
P._nervosum                   ATGTGAATTGCAGAATCCTGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCTGATGCC   [359]
P._cf._tonduzii               ATGTGAATTGCAGAATCCTGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCTGATGCC   [359]
P._sulfuratum                 GTGTGAATTGCAGAATCCCGTGAACCATTGAATCTTTGAACGCAAGTTGCGCCCAATGCC   [351]
D._opuntioides                GTGTGAATTGCAGAATCCCGTGAACCATTGAGTCTTTGAACGCAAGTTGCGCTCAACGCC   [349]
D._domingensis                GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [86]
D._clavata                    GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [351]
D._costaricensis              GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [348]
D._squamigera                 GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCAATGCC   [350]
P._crassifolium               GTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGATGCC   [338]
P._piperoides                 GTGTGAATTGCAGAATCCCGTGAACCATTGAATTTTTGAACGCAAGTTGCGCCCGATGCC   [338]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      430       440       450       460       470       480]
[                                      .         .         .         .         .         .]
P._capitellatum               -ATTT-ATAGGCTGAGGGCACGCCTGCCTGAGTGTCATTCATTG-TACTCCAACCCCAA-   [377]
P._juniperinum                -ATTT-ATAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATTG-TACTCCAACCCCAA-   [422]
P._juniperinum_libocedri      -ATTT-ATAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATTG-TACTCCAACCCCAA-   [422]
P._bolleanum_densum           -ATTT-ATAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATTG-TACTCCAACCCCAA-   [427]
P._bolleanum_pauciflorum      -ATTT-ATAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATTG-TACTCCAACCCCAA-   [427]
P._minutifolium               -ATTT-ATAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATTG-TACTCCAACCCCAA-   [425]
P._bolleanum                  -ATTT-ATAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATTG-TACTCCAACCCCAA-   [425]
P._tomentosum_macrophyllum    -ATTT-GTAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATGG-AACCCCAACCCCAA-   [428]
P._tomentosumM                -ATTT-GTAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATGG-AACCCCAACCCCAA-   [428]
P._serotinum                  -ATTT-GTAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATGG-GACCCCAACCCCAA-   [428]
P._tomentosumTX               -ATTT-GTAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATGG-AACCCCAACCCCAA-   [428]
P._villosum                   -ATTT-ATAGGTGGAGGGCACGCCTGCCTGGGTGTCATTCATGG-TACTCCAACCCCAA-   [423]
P._villosum_coryae            -ATTT-ATAGGCGGAGGGCACGCCTGCCTGGGTGTCATTCATGG-TACTCCAACCCCAA-   [424]
P._scaberrimum                -ATTT-ATAGGCGGAGGGCACGCCTGCCTGGGTGTCATTCATGG-TACTCCAACCCCAA-   [424]
P._galeottii                  -ATTT-ATAGGCGGAGGGCACGCCTGCCTGGGTGTCATTCATGG-TACTCCAACCCCAA-   [423]
P._longifolium                -ATTT-ATAGGCGGAGGGCACKCCTGCCTGGGTGTCATTCATGG-TACTCCAACCCCAA-   [423]
P._robinsonii                 -CTTT-ATAGGGTGAGGGCACGCCTGCCTGGGTGTCATTCATGG-TACTCCAACCCCAA-   [424]
P._rhipsalinum                -ATTT-ATAGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATGG-TACACCAACCCCAA-   [422]
P._brachystachyum             -ATTT-ATAGGCCGAGGGCACGCCTGCCTGGGTGTCATTCATGG-TACTCCAACCCCAA-   [422]
P._velutinumSLP               -ATTT-ATAGGCTGAGGGCWSTCCTGCCGTGGTGTCATTCATGK-AACTCCAACCCGTA-   [422]
P._velutinumM                 -ATTT-ATAGGCTGAGGGCACTCCTGCCTGGGTGTCATTCATGG-AACTCCAACCCCAA-   [422]
P._forestierae                -ATTT-ATTGGCTGAGGGCATGCCTGCCTGGGTGTCATTCATGG-TAGCCCAACCCCAA-   [426]
P._brevifolium                -TTTT-ATTGGTCGAGGGCACGCCTGCCTGGGTGTCATTCCTGG-AACTCCAACCCCAA-   [420]
P._reichenbachianum           -ATTT-ATTGGCTGAGGGCACGCCTGCCTGGGTGTCATTCATGG-TACTCCAGCCCCAA-   [422]
D._guatemalensis              -ATTT-ATAGGTTGAGGGCACGCCTGCCTGGGTGTCATTCATGG-AACTCCAACCCCAA-   [424]
P._vernicosum                 -TTTT-ATAGGTTGAGGGCATGCCTGCCTGGGTGTCATTCATGA-AAC---------AA-   [420]
P._californicum               -ATCC-ATAGGTTGAGGGCTTGCCTGCCTGGGTGTCAAGCATGGGAACTCCATCCCTATC   [425]
P._heydeanum                  CATTT-ATTGGTTGAGGGCATGCCTGCTTGGGTGTCACGCAGGG-TAATTTACCACCAAC   [428]
P._tamaulipense               CATTT-ATAGGTTGAGGGCATGGCTGCTTGGGTGTCACGCACGG-CACTTTACCTCCAAC   [424]
P._trinervium                 CATTT-ATAGGTTGAGGGCATGCCTGCTTGGGTGTCACGTACTG-TTCTTTACCTCCAAC   [425]
P._carneum                    CATTT-ATAGGTTGAGGGCATGTCTGCCTGGGTGTCACGTACGG-TACTTTACCGCCAAT   [421]
P._robustissimum              TGTTT-ATGGGTTGAGGGCATGCCTGCCTGGGTGTCATGTGTGG-TACTTTGCCCCCAAC   [417]
P._nervosum                   CACTT-ATAGGTTGAGGGCATGCCTGCTTGGGTGTCACATATGG-TACTTTACCACCAAC   [417]
P._cf._tonduzii               CACTT-ATAGGTTGAGGGCATGCCTGCTTGGGTGTCACATATGG-TACTTTACCACCAAC   [417]
P._sulfuratum                 -ATTTTAGAGGTGGAGGGCATGCCTGCCTGGGTGTCATGCACGT-AACTCCACCCC----   [405]
D._opuntioides                -ATTTTRTAGGCCGAGGGCATGCCTGCKTGGGTGTCACGYACGG-AACTCCACCCCCAAC   [407]
D._domingensis                -ATTTTATAGGCTGAGGGCATGCCTGCCTGGGTGTCATGCGCGG-AACTCCACCTCGAAC   [144]
D._clavata                    -ATTTTATAGGTTGAGGGCATGCCTGCCTGGGTGTCACGCACAG-AACTCCGCCCCTAAC   [409]
D._costaricensis              -ATTTTATAGGCTGAGGGCATGCCTGCCTGGGTGTCACGCAGAG-AACTCCGCCCCTAAC   [406]
D._squamigera                 -ATTTTATAGGTTGAGGGCATGCCTGCCTGGGCGTCACGCATGG-AACTCCGCCCCTAAC   [408]
P._crassifolium               -ATTTTATAGGCTGAGGGCATGCCTGCCTGGGCGTCACGCACGG-AAGTCCACCCGTAAC   [396]
P._piperoides                 -ATTTTATAGGCTGAGGGCATGCCTGCCTGGGCGTCACGCACGG-AAGTCCACCCGTAAC   [396]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      490       500       510       520       530       540]
[                                      .         .         .         .         .         .]
P._capitellatum               -----------CGGATAGC----------GGG---TCCTGKTGGATCA---GTTCG----   [406]
P._juniperinum                -----------CAGATAGC----------GGG---TCCTGACGGATCA---GTTCG----   [451]
P._juniperinum_libocedri      -----------CAGATAGC----------TGG---TCCTGATCGATCA---GTTCG----   [451]
P._bolleanum_densum           -----------CCGATAGC----------GGG---TCCTGATGGATCA---GTTCG----   [456]
P._bolleanum_pauciflorum      -----------CCGATAGC----------GGG---TCCTGATGGATCA---GTTCG----   [456]
P._minutifolium               -----------CAGATAGC----------GGG---TCCCGATGGATCA---GTTCA----   [454]
P._bolleanum                  -----------CAGATAGC----------GGG---TCCCGATGGATCA---GTTTG----   [454]
P._tomentosum_macrophyllum    -----------CAGATAGC----------CCG---TCCTGATGGATCA---GCTCG----   [457]
P._tomentosumM                -----------CAGATAGC----------GCA---TCCTGATGGATCA---GCTCG----   [457]
P._serotinum                  -----------CAGATAGC----------GCG---TCCTGATGGATCA---GCTCG----   [457]
P._tomentosumTX               -----------CATATAGC----------GCA---TCCTGATGGATCA---GCTCG----   [457]
P._villosum                   -----------TAGATAGC----------GGG---TCCTGATGGATCA---GTTCC----   [452]
P._villosum_coryae            -----------CAGATAGC----------GGG---TCCTGATGGATCA---GTTCG----   [453]
P._scaberrimum                -----------CAGATAGCAGATTGC---GGG---TCCTGATGGATCA---GTTCG----   [460]
P._galeottii                  -----------TAGATAGC----------GGG---TCTTGATGGATCA---GTCCG----   [452]
P._longifolium                -----------CAGATAGC----------GGG---TCCTGATGGATCA---GTTCG----   [452]
P._robinsonii                 -----------CGGTAAGC----------GGG---TCCTGATGGATCT---GTTCA----   [453]
P._rhipsalinum                -----------TATATAGC----------AGG---TCCTGATGGATCA---GTTTG----   [451]
P._brachystachyum             -----------CAGATAGC----------GGG---TCCTGATGGATCA---GTTCG----   [451]
P._velutinumSLP               -----------TAGATAGC----------GGG---TMCMGATSGATCA---GMTCG----   [451]
P._velutinumM                 -----------CAGATAGC----------GCG---TCCAGATGGATCA---GCTCG----   [451]
P._forestierae                -----------CAGATAGC----------GGG---TCCTGATGGATCA---GTTCG----   [455]
P._brevifolium                -----------CAGATAGC----------GGG---TCCTGATGGATTG---GTTTG----   [449]
P._reichenbachianum           -----------CTGATAGC----------GGG---TCCTGATGGATCA---GTTCG----   [451]
D._guatemalensis              ---------------------------------------------------GCTCG----   [429]
P._vernicosum                 GTTCTCACCATCATATAGC----------GGCGGATCCTGATGGATCA---TTTGA----   [463]
P._californicum               ATTCTCTCC-CAATAAATA----------TGGGG-TTATGATGGGTTA---GTTGC----   [466]
P._heydeanum                  ATCCTCCTC-CG------C----------GGTGA-ATTTGGCAGTTCA---TGAGG----   [463]
P._tamaulipense               ATCCTCCAT-GGACAGATT----------GGTGG-TTCTGGAGGATCA---GTTGGCCTC   [469]
P._trinervium                 GTCCTCCAT-GGCCAGATC-------GATGGCGG-TTCTGGAGGACAA---GTTGG----   [469]
P._carneum                    ATCCTCCTT-GGACAAATC----------GGTGG-TTCAGAAGGATAA---GTTGG----   [462]
P._robustissimum              GTCCT---T-GGAAAAATG----------GGTGG-GTCGGAAGGATGC---GTTGG----   [455]
P._nervosum                   ATCCTCCTT-GGACCAATT----------GGTGG-TTCAKAAGGATAA---GTTCG----   [458]
P._cf._tonduzii               ATCCTCCTT--GACAAATT----------GGTGG-TTCAGAAGGATAA---GTTGG----   [457]
P._sulfuratum                 -----------GAC----------------------------GGGCAA---GTTTG----   [419]
D._opuntioides                ATCATCCTT-CGACAAATC----------GGGGG-ATCAGATGGGTMAAAATCGGT----   [451]
D._domingensis                CTCCTCCTC-TAACAAATA----------GGCGG-ATCATATGGGTAAA--GTCAG----   [186]
D._clavata                    ATCCTCCCC-CAACAAACG----------GGGGG-TTCAGATGGATTA---GTCGG----   [450]
D._costaricensis              ATCCTCCCC-CAACAAACG----------GGGGG-TTCAGATGGGTAA---GTCGG----   [447]
D._squamigera                 ATCCTCCCC-CAACAAATA----------GGGGG--TCAGATGGATAA---GCCGG----   [448]
P._crassifolium               CACATCCCC-CAAAAATAG----------GGGG------------------GTTCG----   [423]
P._piperoides                 CACCTCCYC-CAAAAATAG----------GGGG------------------GTTCG----   [423]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      550       560       570       580       590       600]
[                                      .         .         .         .         .         .]
P._capitellatum               ---------------------------------------------TTCAGGGGTGGGCA-   [420]
P._juniperinum                ---------------------------------------------TTCAGGGGTGGGCA-   [465]
P._juniperinum_libocedri      ---------------------------------------------TTCAGGGGTGGGCA-   [465]
P._bolleanum_densum           ---------------------------------------------TTCAGGGGTGGGCA-   [470]
P._bolleanum_pauciflorum      ---------------------------------------------TTCAGGGGTGGGAA-   [470]
P._minutifolium               ---------------------------------------------TTCAGGGGTGGGCA-   [468]
P._bolleanum                  ---------------------------------------------TTCAGGGGTGGGCA-   [468]
P._tomentosum_macrophyllum    ---------------------------------------------TTAGGGGGTGGGTA-   [471]
P._tomentosumM                ---------------------------------------------TTAGGGGGTGGGTA-   [471]
P._serotinum                  ---------------------------------------------TTAGGGGGTGGGTA-   [471]
P._tomentosumTX               ---------------------------------------------TTAGGGGGTGGGTA-   [471]
P._villosum                   ---------------------------------------------TTCGGGGGTGGGTA-   [466]
P._villosum_coryae            ---------------------------------------------TTCGGGGGTGGGTA-   [467]
P._scaberrimum                ---------------------------------------------TTCGGGGGTGGGTA-   [474]
P._galeottii                  ---------------------------------------------TTCGGGGGTGGGTA-   [466]
P._longifolium                ---------------------------------------------TTCGGGGGTGGGTA-   [466]
P._robinsonii                 ---------------------------------------------TTATGGGGTGGGTA-   [467]
P._rhipsalinum                ---------------------------------------------TTA-GGGGTGGGTA-   [464]
P._brachystachyum             ---------------------------------------------TTAGGGGGTGGGTA-   [465]
P._velutinumSLP               ---------------------------------------------TWARGGGGTGGGTA-   [465]
P._velutinumM                 ---------------------------------------------TTAGGGGGTGGGTA-   [465]
P._forestierae                ---------------------------------------------GTAGGTGGTGGGTA-   [469]
P._brevifolium                ---------------------------------------------GTATGGGGTGGGTA-   [463]
P._reichenbachianum           ---------------------------------------------GTAGGGGGTGGGTA-   [465]
D._guatemalensis              ---------------------------------------------GTAGGGGGTGGGTT-   [443]
P._vernicosum                 ---------------------------------------------GTTGGGGGTGGGTA-   [477]
P._californicum               ---------------------------------------------GTA-GGGGTGGGTT-   [479]
P._heydeanum                  --------------------------------------------GGAATGGAGTAGGTT-   [478]
P._tamaulipense               CAACATGCTCCATGGACAGATTGGTGGTTCTGGAGGATGAGTTGGGAATTGGGTAGGTT-   [528]
P._trinervium                 ---------------------------------------------GAATTGGGTTGGGT-   [483]
P._carneum                    ---------------------------------------------GGATGGTGTGGGTT-   [476]
P._robustissimum              ---------------------------------------------GAATGGGGTGGGTC-   [469]
P._nervosum                   ---------------------------------------------GGATGTGGTGGGTT-   [472]
P._cf._tonduzii               ---------------------------------------------GGATGTGGTGGGTT-   [471]
P._sulfuratum                 ---------------------------------------------TATGGGTGTGGGTTT   [434]
D._opuntioides                ---------------------------------------------TATGGGTGTGGGTT-   [465]
D._domingensis                ---------------------------------------------TACGGGTGTGGGTT-   [200]
D._clavata                    ---------------------------------------------TATGGG-GTGGGTT-   [463]
D._costaricensis              ---------------------------------------------TATGGAA--------   [454]
D._squamigera                 ---------------------------------------------TAT-GGGGTGGGCT-   [461]
P._crassifolium               ---------------------------------------------GTACGTGGTGGGTT-   [437]
P._piperoides                 ---------------------------------------------GTACGTGGTGGGTT-   [437]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      610       620       630       640       650       660]
[                                      .         .         .         .         .         .]
P._capitellatum               ATGGCCTCCCGTCCAC--TGTTGCTTGTGGTTGCGGTTGGCTGAAAATTTTCACCC-ATG   [477]
P._juniperinum                ATGGCCTCCCGTCCRC--TTTTGCTCGCGGTTGG------CTAAAATTTTTCACCC-ATG   [516]
P._juniperinum_libocedri      ATGGCCTCCCGTCCAC--TTTTGCTCGCGGTTGG------CTAAAATTTTTCACCC-ATG   [516]
P._bolleanum_densum           ATGGCCTCCCGTCCAC--TGTTGCTCGCGGTTGG------CTAAAATTTTTCACCC-ATG   [521]
P._bolleanum_pauciflorum      ATGGCCTCCCGTCCAC--TGTTGCTCGCGGTTGG------CTAAAATTTTTCACCC-ATG   [521]
P._minutifolium               ATGGCCTCCCGTCCAC--TGTTTCTCGCGGTTGG------CTAAAATTTTTCACCC-ATG   [519]
P._bolleanum                  ATGGCCTCCCGTCCAC--TGTTTCTGGCGGTTGG------CTAAAATTTTTCACCC-ATG   [519]
P._tomentosum_macrophyllum    ATGGCCTCCCGTGCGC--TGTTGCTTGCGGTTGG------CTGAAAAATTTCGCCC-ATG   [522]
P._tomentosumM                ATGGCCTCCCGTGCGC--TGTTTCTCGCGGCTGG------CTGAAAATTTTCGCCC-ATG   [522]
P._serotinum                  ATGGCCTCCCGTGCGC--TGTTGCTCGCGGTTGG------CTGAAAATTTTCGCCC-ATG   [522]
P._tomentosumTX               ATGGCCTCCCGTGCGC--TGTTTCTCGCGGCTGG------CTGAAAATTTTCGCCC-ATG   [522]
P._villosum                   ATGGCCTCCCGTCTAG--TGTTGCTCGCGGTTGG------CTAAAATTTTTCGCCC-ATG   [517]
P._villosum_coryae            ATGGCCTCCCGTCCAG--TGTTGCTCGCGGTTGG------CTAAAATTTTTYGCCC-ATG   [518]
P._scaberrimum                ATGGCCTCCCGTCCAG--TGTTGCTCGCGGTTGG------CTAAAATTTTTCGCCC-ATG   [525]
P._galeottii                  ATGGCCTCCCGTCCAT--TGTTGGTTGCGGTTGG------CTAAAATTTTTTGCCC-ATG   [517]
P._longifolium                ATGGCCTCCCGTCCAT--TGTTGGTCGCGGTTGG------CTAAATTTTTTTGCCC-AYG   [517]
P._robinsonii                 ATGGCCTCCCGTCCTT--TGTTGCTCGCGGTTGG------CTAAAATTTT-CACCC-ATG   [517]
P._rhipsalinum                ATGGCCTCCCGTACAC--GGTGTGTCGCGGTTGG------CTAAAATTT--CACCC-ATG   [513]
P._brachystachyum             ATGGCCTCCCGTACAG--TGTTGGTCGCGGTTGG------CTAAAATTT--CACCC-ATG   [514]
P._velutinumSLP               ATGGCCTCCCGTCCGT--GGTTGCTCGCGGTTGG------CTAMAAATTTACGMCC-ATG   [516]
P._velutinumM                 ATGGCCTCCCGTCCGT--TGTTGCTCGCGGTTGG------CTAAAAATTTTCGCCC-ATG   [516]
P._forestierae                ATGGCCTCCCGTCCAT--TATTTCGTGCGGTTGG------CTAAAATTTTTAGCCC-ATG   [520]
P._brevifolium                TTGGCCTCCCGTCCAT--TATTTCTTGTGGTTGG------CTAAAATTTTTGTCAC-WTT   [514]
P._reichenbachianum           ATGGCCTCCCGTTCGT--TATTTCGCGCGGTTGG------CTAAAATTGTTAGCCC-ATG   [516]
D._guatemalensis              ATGGCCTCCCGTCCAT--CGTTGA--GCGGTTGG------TCGAAATTATGAGCCC-GTG   [492]
P._vernicosum                 ATGGCCTCCCGTCCAT--TGTTGT--GCGGTTGG------TTGAAATTATGAGCCC-ATG   [526]
P._californicum               TTGGCCTCCCGTCTGT--TGTTGC--ACGGTTGG------CTGTAATTATGAGGCC-ATG   [528]
P._heydeanum                  ATGGCCTCCCGTGTTT--TGTTGC--ATGGTTGG------TTGAAATTCAGAGCCC-AAG   [527]
P._tamaulipense               GTGGCCTCCCGTGCGT--CATTGC--ATGGTTGG------TTGAAATTTAGAGCCC-AAG   [577]
P._trinervium                 GTGGCCTCCCGTGTGTGACATTGC--ATGGTTGG------TTGAAATTTAGAGCCC-AAG   [534]
P._carneum                    ATGGCCTCCCGTGTGT--CATTGC--ATGGTCGG------CTGAAATTCAAACCCT-AAG   [525]
P._robustissimum              ATGGCCCCCCGTGTGA--CATTGT--GCGGTCGG------TTGAAATTCAAAGCCT-AAG   [518]
P._nervosum                   ATGGCCTCCCGTGTGC--CAT-GC--ATGGTTGG------CTGAAATTCAAACCCT-AAG   [520]
P._cf._tonduzii               ATGGCCTCCCGTGTGC--CAT-GC--ATGGTCGG------CTGAAATTCAAACCCT-AAG   [519]
P._sulfuratum                 ATGGCCTCCCGTTTGT--CAATGC--ACGGTTGG------TTGAAAATCAGAGCCCCAAG   [484]
D._opuntioides                ATGGCCTCCCGTTCGT--CATTGC--ACGGTTGG------TTGAAATCCAAGGCCT-GAG   [514]
D._domingensis                ATGGCCTCCCGTTCGT--TATYGC--ACGGTTGG------TTGAAATTCAGAGCTT-GAG   [249]
D._clavata                    ATGGCCTCCCGTTTTT--CATTGC--ACGGTTGG------TCGAAATTCAGAGCCC-AAG   [512]
D._costaricensis              ATGGCCTCCCGTTTTT--CATTGC--ACGGTTGG------TCGAAAAATAGAGCCC-AAG   [503]
D._squamigera                 ATGGCCTCCCGTTTTT--CATTGC--ACGGTTGG------TTGAAATTCAGAGCCT-AAG   [510]
P._crassifolium               ATGGCCTCCCGTTTAT--CATTAC--GCGGTTGG------TTGAAATTCAGAGCCC-AAG   [486]
P._piperoides                 ATGGCCTCCCGTTTAT--CATTAC--GCGGTTGG------TTGAAATTCGGAGCCC-AAG   [486]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      670       680       690       700       710       720]
[                                      .         .         .         .         .         .]
P._capitellatum               GTGACATGTG-GTGCGAT---GACTTATGGCTAG---TAATACA--TGCCTTTTATGTCG   [528]
P._juniperinum                GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACC--TGCCTTTTATGTCG   [567]
P._juniperinum_libocedri      GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACC--TGCCTTTTATGTCG   [567]
P._bolleanum_densum           GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACC--TGCCTTTTATGTCG   [572]
P._bolleanum_pauciflorum      GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACC--TGCCTTTTATGTCG   [572]
P._minutifolium               GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACCT-TGCCTTTTATGTCG   [571]
P._bolleanum                  GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACC--TGCCTTTTATGTCG   [570]
P._tomentosum_macrophyllum    GTGGCATGTG-GTGCGAT---GGGTTATGGGTAG---TAGTCCC--TGCCTTTCATGTTG   [573]
P._tomentosumM                GTGGCATGTG-GTGCGAT---GGGTTATGGGTAG---TAGTCCC--TGCCTTTCATGTTG   [573]
P._serotinum                  GTGGCATGTT-GTGTGAT---GGGTTATGGGTAG---TAGTCCC--TGCCTTTCATGTTG   [573]
P._tomentosumTX               GTGGCATGTG-GTGCGAT---GGGTTATGGGTAG---TAGTCCC--TGCCTTTCATGTTG   [573]
P._villosum                   GTGACATGTG-GTCTGAC---GAGTTATGGCTAG---TAATGCC--TGCCTTTTATGTTG   [568]
P._villosum_coryae            GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACC--TGCCTTTTATGTCG   [569]
P._scaberrimum                GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACC--TGCCTTTTATGCCG   [576]
P._galeottii                  GTGACATGTG-GTGCGAT---GAATTATGGCTAG---TAATACC--TGCCTTATATGTCG   [568]
P._longifolium                GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACC--TGCCTTATATGTCA   [568]
P._robinsonii                 GTGACATGTG-GTGCGAT---GAGTAATGGTTAG---CAATGCC--TGCCTTTTATGTCG   [568]
P._rhipsalinum                CTGACATGTG-GTGTGAT---GAGTTGTGGCTAG---AAATACT--TGCTTTTTATGTCG   [564]
P._brachystachyum             CTGACATGTG-GTGCGAT---GAGTTGTGGCTAG---AAATACC--TGCCTTTTATGTCG   [565]
P._velutinumSLP               GTGACATCTG-GYGCTAT---TAGTAATGGGTAG---YAGTCCC--TGYCTTTTATGTCT   [567]
P._velutinumM                 GTGACATCTG-GCGCGAT---GAGTTATGGGTAG---TAGCCCC--TGCCTTTTATGTCG   [567]
P._forestierae                GTGTCATGTG-GTGCGAT---GAGTTATGGCTA---------CC--TGCCTTCTATGTCC   [565]
P._brevifolium                GTGACATGTG-GTGGGATGATGAGTTACGGTTAG---TAATTCC--TGCCTATTATGTCG   [568]
P._reichenbachianum           GTGACATGTG-GTGCGAT---GAGTTATGGCTAG---TAATACT--TGCCTTTTATGTCG   [567]
D._guatemalensis              GTGACATGGG-GTGCGAT---GAGTTATGGCTAG---AAATACC--TGCCTTTTATGTCG   [543]
P._vernicosum                 GTGCCATGCG-GTGTGAT---GAGTTATGGCTCG---TAATACC-TTGCCTGTTATGTCA   [578]
P._californicum               GTGACGTGTG-GCATGAT---GAGTTATGGGTAG---TGGCACT-TTGTTATTTACGTCA   [580]
P._heydeanum                  GTGGCACATG-GTGTGAT---GGGTTGCGATTTA---CTGTAT-----------GTGTCA   [569]
P._tamaulipense               GCGACACGTG-GCGTGAT---GGGTCGTGGTTTG---CTGTAC-----------GTGTCA   [619]
P._trinervium                 GTGACACGTG-CGGTGAT---GGGTTGCGGGTTG---CTGTAC-----------GTGTCA   [576]
P._carneum                    GTGACAAGGT-GTGTGAT---GGGTTGCGGTTCG---CTGTAT-----------GCGTCA   [567]
P._robustissimum              GTGACATGTG-GTGTGAT---GGGTTGTGGTTTG---TTG-AT-----------GTGTCA   [559]
P._nervosum                   GTGACATGTT-CTGTGCT---GGGYTGTGGTTTG---CTGTAT-----------GTGTCA   [562]
P._cf._tonduzii               GTGACATGTTTCTGTGCT---GGGTTGTGGTTTG---CTGTAT-----------GTGTCA   [562]
P._sulfuratum                 GTGACATGCG-GTGTGTT---GAGTTACGGTTAG---CG-TATT--TGCCCTTTATGTCA   [534]
D._opuntioides                GTGACATGCG-GCGTGAT---GAGTTATGATTAG---CGATATT--TGCCTTTCATGTCA   [565]
D._domingensis                GTGACATGCG-GTGCGGT---GAGTTACAATTAG---CGATATT--ATCCTTTCATGTCA   [300]
D._clavata                    GTGATGTGCG-GCGTGAT---GAGTTATGGGTAGTAGCGATACC--CCCCCTT-ATGTCA   [565]
D._costaricensis              GTGACGTGCG-GCGCGAT---GAGTTATGGGTAG---CGATACC--CCCCTTT-ATGTCA   [553]
D._squamigera                 GTGACGTGCG-GCGTGAT---GAGTTATGGGTAG---CGAAACC--CCCCTTTCATGTCA   [561]
P._crassifolium               GTGACATGCG-GCGCGAT---TAATTACGACCAG---CAGTATC--TGCCTTCCATGTCA   [537]
P._piperoides                 GTGACATGCG-GCGCGAT---GARTTACGACCAG---CAGTATC--TGCCTTCCATGTCA   [537]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      730       740       750       760       770       780]
[                                      .         .         .         .         .         .]
P._capitellatum               ACCATGGAAAA--GATTGCATTGACCC--TATGAGGAAA--CCCTG--TTTTCTTTT-AA   [579]
P._juniperinum                ACCATGGAAAA--GATTGCATTGACCC--TATGAGGAAA--CCCTG--TTTTCGTTT-AA   [618]
P._juniperinum_libocedri      ACCATGGAAAA--GATTGCATTGACCC--TATGAGGAAA--CCCTG--TTTTCGTTT-AA   [618]
P._bolleanum_densum           ACCATGGAAAA--GATTGCATTGACCC--TATGAGGAAA--CCCTG--TTTTCGTTT-AA   [623]
P._bolleanum_pauciflorum      ACCATGGAAAA--GATTGCATTGACCC--TATGAGGAAA--CCCTG--TTTTCGTTT-AA   [623]
P._minutifolium               ACCATGGAAAA--TATTTCATTGACCC--TATGAGGAAA--CCCTG--TTTTCGTTT-AA   [622]
P._bolleanum                  ACCATGGAAAA--TATTTCATTGACCC--TATGAGGAAA--CCCTG--TTTTCGTTT-AA   [621]
P._tomentosum_macrophyllum    ACCGTGGAGAA--GATCGCGTTGACCC-CTATGAGGAAA--TCCCG--ATTTGGTTT-AA   [625]
P._tomentosumM                ACCGTGGAAAA--GATCGCGTTGACCC-CTATGAGGAAA--TCCCG--ATTTGGTTT-AA   [625]
P._serotinum                  ACCGTGGAAAA--GATCGCGTTGACCC-CTATGAGGAAA--TCCCG--ATTTGGTTT-AA   [625]
P._tomentosumTX               ACCGTGGAAAA--GATCGCGTTGACCC-CTTTGAGGAAA--TCCCT--ATTTGGTTT-AA   [625]
P._villosum                   ACCATGGAAAA--GATTGCATTGACCC--TATGAGGAAA--CCCTG--TTTTTGTTT-AA   [619]
P._villosum_coryae            ACCATGGAAAA--GATTGCATTGACCC--TATGAGGAAA--CCCTG--TTTTTGTTT-AA   [620]
P._scaberrimum                ACCATGGAAAA--GATTGCATTGACCC--TTTGGGGAAA--CCCTG--TTTTTGTTT-AA   [627]
P._galeottii                  ACCATGGAAAG--GATTGCATTGACCC--TATGTGGAAA--CCCTG--TTTTTGTTT-AA   [619]
P._longifolium                ACCATGGAAAA--GATCGCATTGACCC--TATGTGGAAA--CCCTG--TTTTTGTTT-AA   [619]
P._robinsonii                 ACCGGGGAAAA--GATTGCATTGACCC--TATGAGGAAA--TCCTG--ATTTGGTTT-AA   [619]
P._rhipsalinum                ACCTTGGAAAAA-TATTGCATTGACCC--TGTGAGGAAA--TCCTG--TTTTGGGTT-AA   [616]
P._brachystachyum             ACCATGGAAAAA-GATTGCATTGACCC--TATGAGGAAA--TCCTG--TTTTGGTTT-AA   [617]
P._velutinumSLP               AGCGTGCATAA--GATC-------------------------------AATTGGTCT-AA   [593]
P._velutinumM                 ACCGTGGAAAA--GATCGCATTGACCC--TATGACGAAA--TCCTG--ATTTGGTTT-AA   [618]
P._forestierae                TCCATGGAAAA--GATCGCATTGACCC--TATGAGGAAA--TCCTG---TTTGGTTTTAA   [616]
P._brevifolium                AACATGGAAAA--TATTGCATTGACCC--TATGAGGGAA--TCCTA--TTTTGGTTT-AA   [619]
P._reichenbachianum           ACCATGGAAAA--GATTGCATTGACCC--CATGAGGAAA--TCCTG--TTTTGGTTT-AA   [618]
D._guatemalensis              ACCATGGAG---------CGTTGACCC--TATGAAAGAAA-TCCCG--GTTCTGTTT-AA   [588]
P._vernicosum                 ACCATGTAGTA--GACCCCATTGACCC--TATGTGGAAA--TCCTA--TTCCGGTTT-AA   [629]
P._californicum               TCCATGGAATT--GACTTTGTTGGCCC--CATGAGGAAA-TTCCTC--TTTCTGGTG-GG   [632]
P._heydeanum                  TCCATGGTGAA--GTGCTTGTTGACCC--GATGGTGAAA--TCCCA--TTTTTATTT-GG   [620]
P._tamaulipense               TCCATGGAGAA--GTTTTTGTTGGCCC--CATGCTAGAA--TCCCA--TTAATTTTT-GA   [670]
P._trinervium                 TCCTTGGAGAA--GCTTTTGTTGGCCC--CATGCCAAAA--TCCCA--TTAGTATTT-GA   [627]
P._carneum                    TCCATGGAGAA--GACCTTGTTGACCCC-CATGAGGAAG--TCCCA--TTTTTATTT-CA   [619]
P._robustissimum              TCCATGGCGTA--GACCTTGTTGACCC--CATGATGAGA--TCCCG--GTTTTATTT-GA   [610]
P._nervosum                   TCCATGGAGAA---ACCTCGTTGGCCC--CATGAAGTAG--TCCCA--ATTTCTTTT-GA   [612]
P._cf._tonduzii               TCCATGGAGAA---ACCTTGTTGGCCC--CATGAAGTAA--TCCCA--TTTYYKKTT-GA   [612]
P._sulfuratum                 TCCATGGAAAG-GCCTTCTGTTGACGC--TGTGAGAACA--TCCCA--TTCCCGTTC-AG   [586]
D._opuntioides                TCCATGGAAAA--TCATCAGTTGACCC--CGTGAGAAAA--TCCCA--TCCCGGCTC-GG   [616]
D._domingensis                TCCATGGAAAA--GCATCATTTGACCC--CGTGAGGAAA--TCCCAA-TTCCGGCTC-AG   [352]
D._clavata                    TCCATGGAGAA--GCCTCCGTTGACCA--GATGAGAAAA--TCCCA--TTCCGGTTC-AG   [616]
D._costaricensis              TCCATGGAGAA--GCCTTCATTGACCA--GATGAGAAAA--TCCCA--TTCCGGTTC-AA   [604]
D._squamigera                 TCCATGGAGAA--GCCTTCGTTGACCC--GATGAGAAAA--TCCCA--TTTCGGTTC-AG   [612]
P._crassifolium               TCCATGGAGAA--GAATCCGTTGACCC--CATGAGTAAA--TCCCA--TTCCGGTTC-AG   [588]
P._piperoides                 TCCATGGAGAA--GACTCCGTTGACCC--CATGAGAAAA--TCCCA--TTCCGGTTC-AG   [588]
Korthalsella_latissima        ------------------------------------------------------------   [0]
Acanthosyris_asipapote        ------------------------------------------------------------   [0]
Thesium_carinatum             ------------------------------------------------------------   [0]
[                                      790       800       810       820       830       840]
[                                      .         .         .         .         .         .]
P._capitellatum               CA----CATTAGTTAAT-TGAAGGGGGAA--GYTTGCAGCCCAAATCGGGTGGTAAATTT   [632]
P._juniperinum                CA----CATCAGTTAAT-TGAAGGGGCAA--GYTTGCAGCCCAAATCGGGTGGTAAATTT   [671]
P._juniperinum_libocedri      CA----CATCAGTTAAT-TGAAGGGGCAA--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [671]
P._bolleanum_densum           CA----CATCAGTTAAT-TGAAGGGGGAA--GTTTGCAGCCCAAATCGGGTGGTAAATTT   [676]
P._bolleanum_pauciflorum      CA----CATCAGTTAAT-TGAAGGGGGAA--GTTTGCAGCCCAAATCGGGTGGTAAATTT   [676]
P._minutifolium               CA----CATCAGTTAAT-TGAACGGGGGA--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [675]
P._bolleanum                  CA----CATCAGTTAAT-TGAAGGGGGAA--GC---------------------------   [647]
P._tomentosum_macrophyllum    CA----CATCAGTTAGC-TGAAGGGGGAA--CCTTGCAGCCCAAATCGGGTGGTAAATTT   [678]
P._tomentosumM                CA----CATCAGTTAGC-TGAAGGGGGAA--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [678]
P._serotinum                  CA----CATCAGTTAGC-TGAAGGGGGAA--TCTTGCAGCCCAAATCGGGTGGTAAATTT   [678]
P._tomentosumTX               CA----CATCAGTTAGC-TGAAGGGGGAA--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [678]
P._villosum                   CA----CATCAGTTAAC-TGAAGGGGGAA--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [672]
P._villosum_coryae            CA----CATCAGTTAAC-TGAAGGGGGAA--GTTCGCAGCCCAAATCGGGTGGTAAATTT   [673]
P._scaberrimum                CA----CATCAGTTAAC-TGAAGGGGGAA--GCTCGCAGCCCAAATCGGGTGGTAAATTT   [680]
P._galeottii                  CA----CATCAGTTAAC-TGAAGGGGGG-CAGCTTGCAGCCCAAATCGGGTGGTAAATTT   [673]
P._longifolium                CA----CATCAGTTAAC-TGAAGGGGGGGCAGC---------------------------   [647]
P._robinsonii                 CA----TGATAGTTAGC-TGAAGTGGGAA--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [672]
P._rhipsalinum                CA----CCTTCATTAAC-CGAAGGGGGAT--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [669]
P._brachystachyum             CG----CATCAGTTAAC-CGAAGGG-TAA--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [669]
P._velutinumSLP               CA----CATCACTTART-TGAAGSGGG??--??TTGCAGCCCAAATCGGGTGGTAAATTT   [646]
P._velutinumM                 CA----CATCAGTTAAC-TGAAGGGGGAA--GCTTGCAGCCCAAATCGGGTGGTAAATTT   [671]
P._forestierae                TA----CATCAGTTAAC-AGAAGGGGGAA--TTTTGCAGCCCAAATCGGGTGGTAAATTT   [669]
P._brevifolium                TA----CATCAGTTAAC-AGAAGGGGGAC--TC????????????TCGGGTGGTAAATTT   [672]
P._reichenbachianum           TA----CATCAGTTAAC-AGAATGGGGAA--TCTTGCAGCCCAAATCGGGTGGTAAATTT   [671]
D._guatemalensis              TA----CGTTGGGAACC-GGAA-GGGGAA--TTATGCAGCCCAAATCGGGTGGTAAATTT   [640]
P._vernicosum                 CAAACACATCACAGAGT-GGAATGGGAAA--TCATGCAGCCCAAATCGGGTGGTAAATTT   [686]
P._californicum               CA----CATTCAGAAAT-GGAAGTTATAA--TTACGCAGCCCAAATTGGGTGGTAAATTT   [685]
P._heydeanum                  AT----CATTTGGAAAC-AGATTGGAAAA--TTATGCATCCCAAATCGGGTGGTAAATTT   [673]
P._tamaulipense               AA----CAATAGG-AAC-GGATTGGAA-T--TTATGCAGCCCCAATTGGGTGGTAAATTT   [721]
P._trinervium                 AA----CGTTAGGAAAC-AGATTGGAAAT--TTATGCAGCCCCAATTGGGTGGTAAATTT   [680]
P._carneum                    AA----CATTAGGAAAC-ATATTGGAAAA--TTATGCAGCCCCAATAGGGTGGTAAATTT   [672]
P._robustissimum              AA----CGTTAGGAAGC-ATATCGGAAAA--TT---------------------------   [636]
P._nervosum                   AA----CGT-----------ATTCGAATA--TC????????CAAATCGGGTGGTAAATTC   [655]
P._cf._tonduzii               AA----CGT-----------ATTGGAATA--TCATGCAGCCCCAATCGGGTGGTAAATTT   [655]
P._sulfuratum                 GG----CATAGGATGGA--------CAAA--TC?????GCCCAAATCGGGTGGTAAATTT   [632]
D._opuntioides                GA----CATGGGAGGAA-------AAATA--TC???CAGCCCAAATCGGGCGGTAAATGT   [663]
D._domingensis                GA----CATGGGAAGGA-------AAATA--TC?????GCCCAAATCGGGTGGTAAATGT   [399]
D._clavata                    AA----CATCGGGAGAAGGGAAGGGAAAA--TT?????????????CGGGTGGTAAATTT   [670]
D._costaricensis              AA----CATCGGGAGATGGGAATGGAAAA--TC?TGCAGCCCAAATCGGGTGGTAAATTT   [658]
D._squamigera                 AA----CATCAGGAGATGGGAAGTGAAGA--TCATGCAGCCCAAATCGGGTGGTAAATTT   [666]
P._crassifolium               CA----CATYGGCAAAC-GTAATGGCAAA--TC??????ACCAAATCGGGCGGTAAATTT   [641]
P._piperoides                 AA----CATCGGCAAAC-GTAAGGGAAAA--TC?TGCAGCCCCAATCGGGCGGTAAATTT   [641]
Korthalsella_latissima        ---------------------------------ATGCAGCCCAAATTGGGTGGTAAATTT   [27]
Acanthosyris_asipapote        ---------------------------------ATGCAGCCCAAATCGGGCGGTAAATTC   [27]
Thesium_carinatum             ---------------------------------ATGCAGCCCAAATCGGGCGGTAAAYTC   [27]
[                                      850       860       870       880       890       900]
[                                      .         .         .         .         .         .]
P._capitellatum               CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [692]
P._juniperinum                CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [731]
P._juniperinum_libocedri      CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [731]
P._bolleanum_densum           CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [736]
P._bolleanum_pauciflorum      CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [736]
P._minutifolium               CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [735]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    CGTCCAAGGCTAAATACATGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [738]
P._tomentosumM                CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [738]
P._serotinum                  CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [738]
P._tomentosumTX               CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [738]
P._villosum                   CGTCCAAGGCTAAATACAAGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [732]
P._villosum_coryae            CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [733]
P._scaberrimum                CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [740]
P._galeottii                  CGTCCAAGGCTGAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [733]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 CGTCCAAGGCCAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [732]
P._rhipsalinum                CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [729]
P._brachystachyum             CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [729]
P._velutinumSLP               CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [706]
P._velutinumM                 CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [731]
P._forestierae                CGTCCAAGGCTAAATACTTGCAGGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [729]
P._brevifolium                CGTCCAAGGCTAAATATTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [732]
P._reichenbachianum           CGTCCAAGGCTAAATACTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [731]
D._guatemalensis              CGTCCAAGGCTAAATATTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [700]
P._vernicosum                 CGTCCAAGGCTAAATATTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [746]
P._californicum               CGTCCAAGGCTAAATATTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [745]
P._heydeanum                  CGTCCAAGGCTAAATACTTGTGAGAGACCGATAGTAAACAAGTACCGCGAGGGAAAGATG   [733]
P._tamaulipense               CGTCCAAGGCTAAATATCTGTGAGAGACCGATAGTAAACAAGTACCGCGAGGGAAAGATG   [781]
P._trinervium                 CGTCCAAGGCTAAATATCTGTGAGAGACCGATAGTAAACAAGTACCGCGAGGGAAAGATG   [740]
P._carneum                    TGTCCAAGGCTAAATATGTGTGAGAGACCGATAGTAAACAAGTACCGCGAGGGAAAGATG   [732]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   CGTCCAAGGCTAAATATTTGTGAGAGACCGATAGTAAACAAGTACCGCGAGGGAAAGATG   [715]
P._cf._tonduzii               CGTCCAAGGCTAAATATTTGTGAGAGACCGATAGTAAACAAGTACCGCGAGGGAAAGATG   [715]
P._sulfuratum                 CGTCCAAGGCTAAATATTTGYGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [692]
D._opuntioides                CGTCCAAGGCTAAATATTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [723]
D._domingensis                CGTCCAAGGCTAAATATTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [459]
D._clavata                    CGTCCAAGGCTAAATATTTGTGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [730]
D._costaricensis              CGTCCAAGGCTAAATATTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [718]
D._squamigera                 CGTCCAAGGCTAAATATTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [726]
P._crassifolium               CGTCCAAGGCTAAATATTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [701]
P._piperoides                 CGTCCAAGGCTAAATATTTGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [701]
Korthalsella_latissima        CGTCCAAGGCTAAATACTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [87]
Acanthosyris_asipapote        CGTCCAAGGCTAAATATGGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [87]
Thesium_carinatum             CGTCCAAGGCTAAATATAGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATG   [87]
[                                      910       920       930       940       950       960]
[                                      .         .         .         .         .         .]
P._capitellatum               AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [752]
P._juniperinum                AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [791]
P._juniperinum_libocedri      AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [791]
P._bolleanum_densum           AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [796]
P._bolleanum_pauciflorum      AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [796]
P._minutifolium               AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [795]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [798]
P._tomentosumM                AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [798]
P._serotinum                  AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [798]
P._tomentosumTX               AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [798]
P._villosum                   AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [792]
P._villosum_coryae            AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [793]
P._scaberrimum                AAAAGGACTTTGAAAAGAGGGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [800]
P._galeottii                  AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [793]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [792]
P._rhipsalinum                AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [789]
P._brachystachyum             AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [789]
P._velutinumSLP               AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [766]
P._velutinumM                 AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [791]
P._forestierae                AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGGGGGAAGTGAATGG   [789]
P._brevifolium                AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [792]
P._reichenbachianum           AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGTGAATGG   [791]
D._guatemalensis              AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTTGGGAGGGAAGCGAATGG   [760]
P._vernicosum                 AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGGATGG   [806]
P._californicum               AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTTGGGAGGGAAGTGAATGG   [805]
P._heydeanum                  AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTTGGGAGGGAAGCAAATGG   [793]
P._tamaulipense               AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTTGGGAGGGAAGCGAATGG   [841]
P._trinervium                 AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTTGGGAGGGAAGCGAATGG   [800]
P._carneum                    AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTTGGGAGGGAAGCGAATGG   [792]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTTGGGAGGGAAGCGAATGG   [775]
P._cf._tonduzii               AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTTGGGAGGGAAGCGAATGG   [775]
P._sulfuratum                 AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [752]
D._opuntioides                AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [783]
D._domingensis                AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [519]
D._clavata                    AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [790]
D._costaricensis              AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [778]
D._squamigera                 AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [786]
P._crassifolium               AAAAGGACTTTGAAAAGAGAGTCAAAAAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [761]
P._piperoides                 AAAAGGACTTTGAAAAGAGAGTCAAAAAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [761]
Korthalsella_latissima        AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGGATGG   [147]
Acanthosyris_asipapote        AAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGAATGG   [147]
Thesium_carinatum             AAAAGGACTTTGAAAAGAGATTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGGATGG   [147]
[                                      970       980       990       1000      1010      1020]
[                                      .         .         .         .         .         .]
P._capitellatum               GGGTCGGTAATGTGCCTCGGTCGCACGTGGAACGGTAGTAA---GCTGGTCTATTGAACG   [809]
P._juniperinum                GGGTCGGTAATGTGCCTCGGTCGCACGTGGAACGGTGGTAA---GCTGGTCTGTTGAACG   [848]
P._juniperinum_libocedri      GGGTCGGTAATGTGCCTCGGTCGCACGTGGAACGGTGGTAA---GCTGGTCTGTTGAACG   [848]
P._bolleanum_densum           GGGTCGGTAATGTGCCTCGGTCGCACGTGGAACGGTGGTAA---GCTGGTCTGTTGAACG   [853]
P._bolleanum_pauciflorum      GGGTCGGTAATGTGCCTCGGTCGCACGTGGAACGGTGGTAA---GCTGGTCTGTTGAACG   [853]
P._minutifolium               GGGTCGGTAATGTGCCTCGGTCGCACGTGGAACGGTGGTAA---GCTGGTCTGCTGAACG   [852]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    GGGCCGGTAATGTGCCTCGGTCGCAGGTGGAACGGCGGTAACTTGCTGGTCTGTTGAACG   [858]
P._tomentosumM                GGGCCGGTAATGTGCCTCGGTCGCAGGTGGAACGGCGGTAACCCGCTGGTTTGTTGAACG   [858]
P._serotinum                  GGGCCGGTAATGTGCCTCGGTCGCAGGTGGAACGGCGGTAACCTGCTGGTCTGTTGAACG   [858]
P._tomentosumTX               GGGCCGGTAATGTGCCTCGGTCGCAGGTGGAACGGCGGTAACCCGCTGGTTTGTTGAACG   [858]
P._villosum                   GGGCCGKTAATGTGCCTCGGTCGCAGGTGGAACGGCGGTAACTTGCTGGTCTGTTGAACG   [852]
P._villosum_coryae            GGGTCGGTAATGTGCCTCGGTCGCAGGTGGAACGGTGGTAA---GCTGGTTCGTTGAACG   [850]
P._scaberrimum                GGGTCGGTAATGTGCCTCGGTCGCAGGTGGAACGGTGGTAA---GCTGGTTCGTTGAACG   [857]
P._galeottii                  GGGTCGGTAATGTTTCTCGGTTGCACGTGGAACGGTGGTAA---GCTGGTCCGTTGAACG   [850]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 GGGCCGGTAATGTGCCTCGGTCGCATGTGGAACGGTGGTAA---GCTGGTCTGTTGAATG   [849]
P._rhipsalinum                GGGCCGGTAATGTGCCTCGGTTGCATGTGGAACGGTGGTAA---GCTGGTCTGTTGAACG   [846]
P._brachystachyum             GGGCCGGTAATGTGCCTCGGTCGCACTTGGAACGGCGGTAA---GCTGGTCTGTTGAACG   [846]
P._velutinumSLP               GGGCCGGTAATGTGCCTCGGTCGCACGTGGAACGGTGGTAA---CCTGGTCTGCTGAACG   [823]
P._velutinumM                 GGGCCGGTAATGTGCCTCGGTCGCACGTGGAACGGTGGTAA---CCTGGTCTGCTGAACG   [848]
P._forestierae                GGGCCGGTAATGCGCCTCGGTCGCATGTGGAACGGTGGTAA---GCTGGTCTGTTGAATG   [846]
P._brevifolium                GGGCCGGTAATGTGCCTCGGTCGCACGTGGAACGGCGGTAA---GCTGGTCTGTTGAACG   [849]
P._reichenbachianum           GGGTCGGTAATGTGCCTCGGTCGCACGTGGAACGGTTGTAA---TCTGGTCTGTTGAACG   [848]
D._guatemalensis              GGTCCGGTAATGTGCCTCGGTCGCATGTGGAACGGT-GTAA---GCTGGTCTGCTGAACG   [816]
P._vernicosum                 GGGTCGGCAATGTGCCTTGGCCGCATGTGGAACGGTGGTAA---GCTGGTCTGCTGGACG   [863]
P._californicum               GGGTTGGCAATGTGCCTTGGTTGCATGTGGAACGGCGGTAA---GCCGGTTGATTGAACG   [862]
P._heydeanum                  GGGCAGGCAATGTGCCTCGGTCGCATGTGGAACGGTTTTAT---GCCGGCTTGCTGGTTG   [850]
P._tamaulipense               GGGCAGGCAATGTGCCTCAGTCGCATGCAGAACGGTCTTCT---GCCGGTTTGCTGGTTG   [898]
P._trinervium                 GGGCAGGCAATGTGCCTCAGTCGCATGCAGAACGGTCTTCT---GCCGGTTTGCTGGTTG   [857]
P._carneum                    GGGCAGGCAATGTGCCTCGGTCGCATGTGGAACGGTCTTAT---TCCGGTTTGCTGGTTG   [849]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   GGGCAGGCAATGTGCCTCGGTCACATGTGGAACGGTCTTAT---TTCGGTTTGCTGGTTG   [832]
P._cf._tonduzii               GGGCAGGCAATGTGCCTCGGTCACATGTGGAACGGTCTTAT---TTCGGTTTGCTGGTTG   [832]
P._sulfuratum                 GGGCCGGCAATGYGCCTCGGTCGCATRCGGAACGGTCGTAA---GCCGGTCCGTCGATCG   [809]
D._opuntioides                GGGCCGGCAATGCACCTCGGTCGCATGCGGAACGGTCGTAA---GCCGGTTCGTCGATCG   [840]
D._domingensis                GGGCCGGCAATGCGCCTCGGTCGCATGCGGAACGGTCGTAA---TCCGGTTCGTCGATCG   [576]
D._clavata                    GGGTCGGCAATGCGCCTCGGTCGCATGCGGAACGGTMGTAA---GCCGGTCCGTCGATCG   [847]
D._costaricensis              GGGCCGGCAATGCGCCTCGGTCGCATGCGGAACGGTCGTAA---GCCGGTCCGTCGATCG   [835]
D._squamigera                 GGGCCGGCAATGCGCCTCGGTCGCATGCGGAACGATGGTAA---GCCGGTCCGTCGATCG   [843]
P._crassifolium               GGGCCGGCAATGTGCCCCGGTCGCATGCGGAACGGTCATAA---GCCGGTCCGCCGATCG   [818]
P._piperoides                 GGGCCGGCAACGTGCCCCGGTCGCATGCGGAACGGTCATAA---GCCGGTCCGCCGATCG   [818]
Korthalsella_latissima        GGGTCGGCGATGCGACTCGGTCGCATGCGGAACGGTTGTGA---GCCGGTCTGCCAATCG   [204]
Acanthosyris_asipapote        GGGTCGGCGATGCACCTCGGTCGAATGTGGAACGGCCACAA---GCCGGTTCGCCGATCG   [204]
Thesium_carinatum             GGSCCGGCGATGCSCYTCGKTMACATGTGGAACGKTCA-AA---GCCGGTCCGCCGATTG   [203]
[                                      1030      1040      1050      1060      1070      1080]
[                                      .         .         .         .         .         .]
P._capitellatum               ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-GT-   [867]
P._juniperinum                GTTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATTCTTTCGAT-AT-   [906]
P._juniperinum_libocedri      ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [906]
P._bolleanum_densum           ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [911]
P._bolleanum_pauciflorum      ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [911]
P._minutifolium               ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTAGAAGTTGATGCTTTCGAT-AT-   [910]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    GCTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [916]
P._tomentosumM                GCTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [916]
P._serotinum                  GCTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [916]
P._tomentosumTX               GCTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [916]
P._villosum                   ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-GT-   [910]
P._villosum_coryae            ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGAAGCTTTCGAT-AT-   [908]
P._scaberrimum                ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGAAGCTTTCGAT-AT-   [915]
P._galeottii                  ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCTGCTGAAGTTGATTCTTTCGAT-CT-   [908]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGGT-AT-   [907]
P._rhipsalinum                ACTCGAGGTGCGGGTCAAAGCYGATTGAGGTGGCAGTTGAAGTTGATGCTTTTGAT-ATA   [905]
P._brachystachyum             ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-ATA   [905]
P._velutinumSLP               GCTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [881]
P._velutinumM                 GCTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-AT-   [906]
P._forestierae                ACTCGAGGTGCGGGTTGAAGCTGATTGAGGTGGCAGTTGAAGTTGTTGCTTTTGAT----   [902]
P._brevifolium                ACTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTTGATGCTTTCGAT-ATA   [908]
P._reichenbachianum           ACTCGAGGTGTGGGTCGAAGCTGATTGAGGTGGCAGTTGAAGTCGATTCTTTCGAA-AT-   [906]
D._guatemalensis              GCTCGAGGTGCGGGTCGAAGCTGATTGAGGTGGCGGTTGAAGCTGATGCTTTCGAT-GC-   [874]
P._vernicosum                 ACTCGAGGTGTGGGTCGAAGGTGATTGAGGTGGAGGTCGAAGTTGATGGTTATGAT-AC-   [921]
P._californicum               ACTCGAGGTGCGGGTCGAAGTTGATTAAGGTGGTGATTGTCTCTGAGGTTGTTGAT-AC-   [920]
P._heydeanum                  ACTTGAGGTGCGGGTTGAAGGGGATTGAGGTGGCTGTTGTAGTTGAAGCTATCGAT-AC-   [908]
P._tamaulipense               ACTTGAGGTGCGGGTCAAAGTGGATTGAGGTGGCTGTTGAAGCTGAAGCTATTGAT-AC-   [956]
P._trinervium                 ACTTGAGGTGCGGGTCAAAGTGGATTGAGGTGGCTGTTGAAGCTGAAGCTATCGAT-GC-   [915]
P._carneum                    ACTCGAGGTGCGGGTTGAAGCGGATTGAGGTGGCTGTTGAACCTGAAGCTATGGAT-AC-   [907]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   ACTCGAGGTGCGGGTTGAAGCGGATTGAGGTGGCTGTTGAAGCTGAAGCTATGGAT-AC-   [890]
P._cf._tonduzii               ACTCGAGGTGCGGGTTGAAGCGGATTGAGGTGGCTGTTGAAGCTGAAGCTATGGAT-AC-   [890]
P._sulfuratum                 GCTCGAGGTGCGGGTCGAAGTGGATTGAGGTGGCGGTCGAAGCCGAAGCTATAGAC-AC-   [867]
D._opuntioides                GCTCGAGGTGCGGGTCGAAGCGGATTGAGGTGGCGGTGAAAGCTGAAGGTACAGAC-AT-   [898]
D._domingensis                GCTCGAGGTGCGGGTCGAAGCGGATTGAGGTGGCGGTGAAAGCCGAAGCTATAGAC-AC-   [634]
D._clavata                    GCTCGAGGTGCGGGTCGAAGCAGATTGAGGTGGCGGTCGAAGCCAAAGCTATAGAC-AC-   [905]
D._costaricensis              GCTCGAGGTGCGGGTCAAAGCGGATTGAGGTGGCGGTTGAAGCCGGAGCTATAGAC-AC-   [893]
D._squamigera                 GCTCGAGGTGTGGGTCGAAGCGGATTGAGGTGGCGGTCGAAGCCGAAGCTATAGAC-AC-   [901]
P._crassifolium               ACTCGAGGCGCGGGTCGAAGCGGATCGAGGTGGCGGTTGAAGCCGGAGCTATCGCT-AC-   [876]
P._piperoides                 ACTCGAGGCGCGGGTCGAAGCGGATCGAGGTGGCGGTTGAAGCCGGAGCTATCGCT-AC-   [876]
Korthalsella_latissima        GCTCGAGTTGTGGGTCGATGCGGATTGTGGCGGCGGTCAAAGCCCGAGCTTTTGATGAT-   [263]
Acanthosyris_asipapote        ACTCGGGGTGTGGATCGATGCGGATTGTGGCGGCGGCCAAAGCCCAAGCTGTCGAT-AT-   [262]
Thesium_carinatum             GCTCGAGGCGCGGATCGACGCGGATTCGGGCGGCGGCCTAAGCCCGGGCTGTTGAT-AT-   [261]
[                                      1090      1100      1110      1120      1130      1140]
[                                      .         .         .         .         .         .]
P._capitellatum               -AGCCTTT-TGGATACGTTGTCGCC--TTGATCATTGTGGGTAGTGCGTGCTCGAAGCGA   [923]
P._juniperinum                -AGCCTTT-CGGATACGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [962]
P._juniperinum_libocedri      -AGCCTTT-CGGATACGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [962]
P._bolleanum_densum           -AGCCTTT-CGGATACGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [967]
P._bolleanum_pauciflorum      -AGCCTTT-CGGATACGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [967]
P._minutifolium               -AGCCTTT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [966]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    -AGCCATT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [972]
P._tomentosumM                -AGCCATT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [972]
P._serotinum                  -AGCCATT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [972]
P._tomentosumTX               -AGCCATT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [972]
P._villosum                   -AGCCATT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [966]
P._villosum_coryae            -AGCGTTT-CGGATATGTTGTCCCC--TTGATCATTGTGTGCAGTGCGTGCTTCAAGCGA   [964]
P._scaberrimum                -AGCGTTT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [971]
P._galeottii                  -AGCCTTT-CGGATATGTTGTCCCC--TTGATCATTGTGGGTAGTGCGTGCTTCAAGCGA   [964]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 -GGCCTTT-CGGATATGTTGTCCCC--TTGATCATTGTGGGTAGTGCGTGCTTCAGGCGA   [963]
P._rhipsalinum                TAGCCTTT-CGGATATGTTGTTCCC--TTGATCGTTGTGGGCAGTGCGTGCGTCAAGCGA   [962]
P._brachystachyum             TAGCCTTT-CGGATATGTTGTCCCC--TTGATCGTTGTGGGCGGTGCGTGCTTCAAGAGA   [962]
P._velutinumSLP               -GGCCATT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [937]
P._velutinumM                 -AGCCATT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAAGCGA   [962]
P._forestierae                -AGCCTTTGCGGATATGTTGTCCCC--TTGATCATTGTGGGTAGTGCGTGCTTCAAGCGA   [959]
P._brevifolium                TAGCCTTT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCAGTGCGTGCTTCAGGCGA   [965]
P._reichenbachianum           -AGCCTTT-CGGATATGTTGTCCCC--TTGATCATTGTGGGCTGTGCGTGCTTCAAGCGA   [962]
D._guatemalensis              -AGCCTTT-CGGATATGCTTTCCCC--TTGATCATTGCTGGCATTTCGCGCTTTAAGCGA   [930]
P._vernicosum                 -AGCCTT--CGGATATGTGCTCGCC--TTGATCATTGCAGGTAGTGCGCGCTTTAAGCGA   [976]
P._californicum               -GACCTTT-TGAATATGTTTTGCCCCATTGATCATTATAGG-AGTGTGCCTTTTTAGCGT   [977]
P._heydeanum                  -AGCCTTT-TGGTTATGTGGCCCCC--CTGATCATTACAGGAAGTGTGCGCTTGAAGCGA   [964]
P._tamaulipense               -AGCCTTT-TGGACATGTGGTCCCC--TTGATCATTACGGGAAGTGTGCGCTTTAAGCGA   [1012]
P._trinervium                 -AGCCTTC-TGGACATGTGGTCCCC--TTGATCATTACGGGGAGTGTGCGCTCTACGCGA   [971]
P._carneum                    -GGCCTTT-CGGATATGTGGTCCCC--TTGATCATTATGGGAAGTGTGCGCTTTATGCGA   [963]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   -GGCCTTT-TGGATATGTGGTCCCC--TTGATCATTATGGGAAGTGTGCGTTTTATGCGA   [946]
P._cf._tonduzii               -GGCCTTT-TGGATATGTGGTCCCC--TTGATCATTATGGGAAGTGTGCGTTTTATGCGA   [946]
P._sulfuratum                 -AGCCTTC-CGGATATGCCGTCCCC--TTGATCATCACAAGCAACGCGCGCTTCAAGCGA   [923]
D._opuntioides                -AGCCTTT-CTGATATGCCGTCCCC--TTGATCATCACCGGCAACGCGCGCTCCAAGCGA   [954]
D._domingensis                -AGCCTTT-CGGATATGCCGTCCCC--TTGATCATCACCGATAACGCGCGCTCCAAGCGA   [690]
D._clavata                    -AGCCTTT-CGGATATGCCGTCCCC--TTGATCATCACCGGCAACGCGCGCTTCAAGCGA   [961]
D._costaricensis              -AGCCTTT-CGGATATGCCGTCCCC--TTGATCATCACCAGCAACGCGCGCTTCAAGCGA   [949]
D._squamigera                 -AGCCTTT-CGGATATGCCGTCCCC--TTGATCATCACCGGCAACGCGCGCTTCAAGCGA   [957]
P._crassifolium               -ADCCTTC-CGGGCATGCCGTCCCC--TCGATCATCACGGGCAGCGCGCGCTTCTAGCGG   [932]
P._piperoides                 -AGCCTTC-CGGGCATGCCGTCCCC--TCGATCATCACGGGCAGCGCGCGCTTCTAGCGG   [932]
Korthalsella_latissima        --GC-TTG-CGGAGATGTCGTCGTC--ATAATTGTGGATGAAATCGTGCATCGTTATGGT   [317]
Acanthosyris_asipapote        --GC-TTG-TGGAGATGTCGTCGCC--TCGATTGTGGCGAGCAGCACGCGCC-TTCACGG   [315]
Thesium_carinatum             --GC-CTG-TGGGGATGTCGTCGCC--CTGATCATGGTAGGCAGCGCGCGCCG--CAGGG   [313]
[                                      1150      1160      1170      1180      1190      1200]
[                                      .         .         .         .         .         .]
P._capitellatum               TGTGGTTTAGCACCTTCGCGCTTCAGGAAATGACTTGTGGGCTCCCCATTCGACCAGCTG   [983]
P._juniperinum                TGTGGTTTAGCACCTTCGCGCTTAAGGAAATGACTTGTGGGCTCCCCATTCGACCAGCTG   [1022]
P._juniperinum_libocedri      TGTGGTTTAGCACCTTCGCGCTTAAGGAAATGACTTGTGGGCTCCCCATTCGACCAGCTG   [1022]
P._bolleanum_densum           TGTGGTTTAACACCTTCGCGCTTAAGGAAATGACTCGTGGGCTCCCCATTCCACCAGCTG   [1027]
P._bolleanum_pauciflorum      TGTGGTTTAACACCTTCGCGCTTAAGGAAATGACTCGTGGGCTCCCCATTCGACCAGCTG   [1027]
P._minutifolium               TGTGGTTTAACACCTTCGCGCTTAAGGAAATGACTCGTGGGCTCCCCATTCGACCAGCTG   [1026]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    TGTGGTTAAGCACCTTCGCGCTTAAGGCAATGACTCGTGGGCCCCCCATTCGACCAGCTG   [1032]
P._tomentosumM                TGTGGTTAGGCACCTTCGCGCTTAAGGCAATGACTCGTGGGCTCCCCATTCGACCAGCTG   [1032]
P._serotinum                  TGTGGTTAAGCACCTTCGCGCTTAAGGCAATGACTCGTGGGCTCCCCATTCGACCAGCTG   [1032]
P._tomentosumTX               TGTGGTTAGGCACCTTCGCGCTTAAGGCAATGACTCGTGGGCTCCCCATTCGACCAGCTG   [1032]
P._villosum                   TGTGGTTAAGCACCTTCGCGCTTAAGGCAATGACTYGTGGGCCCCCCATTCGACCAGTTG   [1026]
P._villosum_coryae            TGTGGTTTAGCACCTTCGCGTTCAAGGCAATGACTCGTGG-CTCCCCATTCGACCAGCTG   [1023]
P._scaberrimum                TGTGGTTTAGCACCTTCGGGCTCAAGGCAATGACTCGTGGGCTCCCCATTCGACCAGCTG   [1031]
P._galeottii                  TGTGGTTTAGCACCTTCGTACTTAAGGAAATGACTCGTGGACTCCCCATTCGACCAGCTG   [1024]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 TGTGGTTTAGCACCTTCGCGCTTAAGGCAATGCCTCGTGGGCTCCCCATTCGACCGGCTG   [1023]
P._rhipsalinum                TGTGGATTATCACCTTCGTGCTTAAGGCAATGACTTGCGGGATCCCCATTCGACCAGCTG   [1022]
P._brachystachyum             AGTGGTTTATCACCTTCGTGCTTAAGGCAATGACTCGTGGGCTCCCCATTCGACCAGCTG   [1022]
P._velutinumSLP               TGTGGTATAGCTCCTTCGCGCTTAAGGCAATGACTCGTGGGCTCCCCATTCGACCAGTTG   [997]
P._velutinumM                 TGTGGTATAGCTCCTTCGCGCTTAAGGCAATGACTCGTGGGCTCCCCATTCGACCAGCTG   [1022]
P._forestierae                TGTGGTTTAGCACCTTCGCGCTTAAGGCAATGACTCGTGGGCTCCCCATTCGACCAGTTG   [1019]
P._brevifolium                TGTGGTTTAGCACCTTCGCTCTTAAGGCAATGGCTTGTGGGCTCCCCATTCAACCAGTTG   [1025]
P._reichenbachianum           TGTGGTTTAGCACCTTCGCGCTTAAGGAAATGACTCGTGGGCTCCCCATTCGACCAGTTG   [1022]
D._guatemalensis              TGTGATTTAGCACCTGCGCGCTTAAGGCAACGACTCGTGGGCTCCCCATTCGACCAGCTG   [990]
P._vernicosum                 TGTTATTTAGCACCAGCGCGCTCAAGGCAACGACTTGTGGGCTCCCCATTTGACCGGCTG   [1036]
P._californicum               TGCAGTTTTGCAGCTG-ACACTCCAGGCGTCGGCTTGTGGGCTCCTCATTTAACCAGTTG   [1036]
P._heydeanum                  TGTGCTTTTGCACATGTGCACTCTAGGCATCAACTTGTGTGCTCGTCATT?????AGCTG   [1024]
P._tamaulipense               TGCGTTTTTGCACCAGTGCACTCCATGCATCAACTCGTGKGCTCCTCATTCGACCGGCTG   [1072]
P._trinervium                 TGTGTTTTTGCACCTGCGCGCTGCATGCATCGACTCGTGTGCTCCTCATTCGACCAGCTG   [1031]
P._carneum                    TGTGTTTTTGCACCAGTGCACTCCATGTATCTACTCGTGTGCTCCTCATTTGACCAGCTG   [1023]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   TGTGTTTTTGCAACGGTGCACTCCGTGAATCTACTCGTGTGCTCCTCATTTGACCAGCTG   [1006]
P._cf._tonduzii               TGTGTTTTTGCATCGGTGCACTCCGTGAATCTACTCGTGTGCTCCTCATTTGACCAGCTG   [1006]
P._sulfuratum                 TGTGCTTCAGCACCTGCGTGCTTAAAGCATCGACTCGTGGTTGCCTCATTCGACC??CTG   [983]
D._opuntioides                TGCGCTTCAGCATCGGCGTGCTTCGGGCATCGACTCGTGGGCTCCTCATCTGACCAGCTG   [1014]
D._domingensis                TGCGCATCAGCATCGGCGTGCTTCGGGCATCGACTCGTGGGCTCCTCATCTGACCAGCTG   [750]
D._clavata                    TGCGCATCAGCACCAGCGCGCTCCGGGCATCGACTCGTGGGCTCCTCATTCGACCAGCTG   [1021]
D._costaricensis              TGCGCTTCAGCATCGGTGTGCTCCGGGCATCGACTCGTGGGCTCCTCATTCGACCAGCTG   [1009]
D._squamigera                 TGCGCTTCAGCACCAGCGTGCTCCGGGCATCGACTCGTGGGCTCCTCATTCGACCAGCTG   [1017]
P._crassifolium               TGCGTGTCAGCACCCGCGCGCTCCATGCATCGACTCGTGGTCTCCTCACTAGACCAGCCG   [992]
P._piperoides                 TGCGTGTCAGCACCCGCGCGCTCCATGCATCGACTCGTGGGCTCCTCATTCGACCAGCCG   [992]
Korthalsella_latissima        GGTGCTACGGCACCTGCACGCTCCAGGCATCGTCCCGTGGGCTCCCCATTCGACCGGCTG   [377]
Acanthosyris_asipapote        CGTGCTTCGGCACCTGCGTGCTCTGGGCATCGACCTGTGGGCTCCCCATTCGGCCGGTTG   [375]
Thesium_carinatum             CGTGCTTCGGCACCTGCGCGCTCCTGGCGTCGGCCTGTGGGCTCCCCATTCGACCGGCTG   [373]
[                                      1210      1220      1230      1240      1250      1260]
[                                      .         .         .         .         .         .]
P._capitellatum               GAACGGCACCGCACGTCGCGTGGTGTTCGATGCACCCTCATCGGCCCTTGAAAATCTGGA   [1043]
P._juniperinum                GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1082]
P._juniperinum_libocedri      GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1082]
P._bolleanum_densum           GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1087]
P._bolleanum_pauciflorum      GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1087]
P._minutifolium               GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1086]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1092]
P._tomentosumM                GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1092]
P._serotinum                  GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1092]
P._tomentosumTX               GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1092]
P._villosum                   GAACGGCACCGCACGTCGCGTGGTGTTTGATGTGCCCTCATCGGCCCTTGAAAATCTGGA   [1086]
P._villosum_coryae            GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1083]
P._scaberrimum                GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1091]
P._galeottii                  GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATTGGCCCTTGAAAATCTGGA   [1084]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCCCATCGGCCCTTGAAAATCTGGA   [1083]
P._rhipsalinum                GAACAACAYCGCACGTCGCGTGGTGTTTGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1082]
P._brachystachyum             GAACGACACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1082]
P._velutinumSLP               GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1057]
P._velutinumM                 GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCATCGGCCCTTGAAAATCTGGA   [1082]
P._forestierae                GAATGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGTCGGCCCTTGAAAATCTGGA   [1079]
P._brevifolium                GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTTTTCGGCCCTTGAAAATCTGGA   [1085]
P._reichenbachianum           GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGTCGGCCCTTGAAAATCTGGA   [1082]
D._guatemalensis              GAACGGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTTGGCGGCCCTTGAAAATCTGGA   [1050]
P._vernicosum                 GAACGGCATCGCACGTCGCGTGGTGTTCGATGCGCCCTCGACGGCCCTTGAAAATCTGGA   [1096]
P._californicum               GAACAACACCGCACGTCGCGTGGTGTTCGAAGTGCCCTTATCGCCCCTTGAAAATTTGGA   [1096]
P._heydeanum                  GAACACCACCGCACGTCGCGCGGTGTCTGATGCGCCCTTGTAGGCCCTTGAAAATCTGGA   [1084]
P._tamaulipense               GAACAGCACCGCACGTCGCGTGGTGTTTGATGCGCCCTTGAAGGCCCTTGAAAATCTGGA   [1132]
P._trinervium                 GAACAGCACAGCACGTCGCGTGGTGTTTGATGCGCCCTTGAAGGCCCTTGAAAATCTGGA   [1091]
P._carneum                    GAACAGCACCGCACGTCGCGTGGTGTTTGATGCGCCCTTGCAGGCCCTTGAAAATCTGGA   [1083]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   GAACAGCACCGCACGTCGCGTGGTGTTTGATGCGCCCTTGCAGGCCCTTGAAAATCTGGA   [1066]
P._cf._tonduzii               GAACACCACCGCACGTCGCGTGGTGTTTGATGCGCCCTTGCAGGCCCTTGAAAATCTGGA   [1066]
P._sulfuratum                 GAACAGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCAGCGGCCCTTGAAAATCCGGA   [1043]
D._opuntioides                GAACAGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGGCGGCCCTTGAAAATCCGGA   [1074]
D._domingensis                GAACAGCACCGCACGTCGCGYGGTGTTCGATGCGCCCTCGGCGGCCCTTGAAAATCCGGA   [810]
D._clavata                    GAACAGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGGCGGCCCTTGAAAATCCGGA   [1081]
D._costaricensis              GAACAGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGGCGGCCCTTGAAAATCCGGA   [1069]
D._squamigera                 GAACAGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGGCGGCCCTTGAAAATCCGGA   [1077]
P._crassifolium               GAACAGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGGCGGCCCCTGAAAATCCGGA   [1052]
P._piperoides                 GAACAGCACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGGCGGCCCCTGAAAATCCGGA   [1052]
Korthalsella_latissima        GAACAACACCGCACGTCGCGTGGTGTTCGATGCGCCCTCGGCGGCCCTTGAAAATCTGGA   [437]
Acanthosyris_asipapote        GAACAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCTCGGCGGCCCTTGAAAATCCGGA   [435]
Thesium_carinatum             GAACAGCACCGCACGTCGCGTGGTGTCCGGTGCGCCCTCGGCGGCCCTTGAAAATCCGGA   [433]
[                                      1270      1280      1290      1300      1310      1320]
[                                      .         .         .         .         .         .]
P._capitellatum               GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1103]
P._juniperinum                GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1142]
P._juniperinum_libocedri      GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1142]
P._bolleanum_densum           GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1147]
P._bolleanum_pauciflorum      GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1147]
P._minutifolium               GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1146]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1152]
P._tomentosumM                GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1152]
P._serotinum                  GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1152]
P._tomentosumTX               GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1152]
P._villosum                   GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1146]
P._villosum_coryae            GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1143]
P._scaberrimum                GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1151]
P._galeottii                  GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1144]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1143]
P._rhipsalinum                GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1142]
P._brachystachyum             GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1142]
P._velutinumSLP               GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1117]
P._velutinumM                 GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1142]
P._forestierae                GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1139]
P._brevifolium                GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1145]
P._reichenbachianum           GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1142]
D._guatemalensis              GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1110]
P._vernicosum                 GGACCGTGTGCCTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1156]
P._californicum               GGACCATGTGCTTTCCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAT   [1156]
P._heydeanum                  GGACCGTGTGCCTTTCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1144]
P._tamaulipense               GGACCGTGTGCCATTCATGCTCAGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1192]
P._trinervium                 GGACCGTGTGCCATTCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGAGAAC   [1151]
P._carneum                    GGACCGTGTGCCTTTCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1143]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   GGACCGTGTGCCTTTCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1126]
P._cf._tonduzii               GGACCGTGTGCCTTTCATGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1126]
P._sulfuratum                 GGACCGTGTGCCTTCCATGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1103]
D._opuntioides                GGACCGTGTGCCTTCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1134]
D._domingensis                GGACCGTGTGCCTTCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [870]
D._clavata                    GGACCGTGTGCCTTCCATGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1141]
D._costaricensis              GGACCGTGTGCCTTCCATGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1129]
D._squamigera                 GGACCGTGTGCCTTCCATGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1137]
P._crassifolium               GGACCGTGTGCCTTCCATGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1112]
P._piperoides                 GGACCGTGTGCCTTCCATGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [1112]
Korthalsella_latissima        GGACCGAGTGCCTTCCATGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [497]
Acanthosyris_asipapote        GGACCGAGTGTCATCCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [495]
Thesium_carinatum             GGACCGTGTGCCGTCCACGCTCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAAC   [493]
[                                      1330      1340      1350      1360      1370      1380]
[                                      .         .         .         .         .         .]
P._capitellatum               AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1163]
P._juniperinum                AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1202]
P._juniperinum_libocedri      AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1202]
P._bolleanum_densum           AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1207]
P._bolleanum_pauciflorum      AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1207]
P._minutifolium               AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1206]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1212]
P._tomentosumM                AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1212]
P._serotinum                  AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1212]
P._tomentosumTX               AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1212]
P._villosum                   AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCATAACCTC   [1206]
P._villosum_coryae            AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1203]
P._scaberrimum                AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1211]
P._galeottii                  AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1204]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1203]
P._rhipsalinum                AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1202]
P._brachystachyum             AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1202]
P._velutinumSLP               AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1177]
P._velutinumM                 AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1202]
P._forestierae                AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1199]
P._brevifolium                AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1205]
P._reichenbachianum           AGCCTTTGGTCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1202]
D._guatemalensis              AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1170]
P._vernicosum                 AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1216]
P._californicum               AGCCTCTGGCCCATGGAATAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1216]
P._heydeanum                  AGCCTCTGGCCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1204]
P._tamaulipense               AGCCTCTGGCCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1252]
P._trinervium                 AGCCTCTGGCCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1211]
P._carneum                    AGCCTCTGGCCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1203]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   AGCCTCTGGCCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1186]
P._cf._tonduzii               AGCCTCTGGCCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1186]
P._sulfuratum                 AGCCTCTGGCCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1163]
D._opuntioides                AGCCTCTGGTCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1194]
D._domingensis                AGCCTCTGGTCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [930]
D._clavata                    AGCCTCTGGTCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1201]
D._costaricensis              AGCCTCTGGTCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1189]
D._squamigera                 AGCCTCTGGTCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1197]
P._crassifolium               AGCCTCTGGTCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1172]
P._piperoides                 AGCCTCTGGTCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [1172]
Korthalsella_latissima        AGCCTCTGGTCCATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [557]
Acanthosyris_asipapote        AGCCTCTGGTCAATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [555]
Thesium_carinatum             AGCCTCTGGCCAATGGAACAATGTAGGCAAGGGAAGTCGGCAAAATGGATCCGTAACCTC   [553]
[                                      1390      1400      1410      1420      1430      1440]
[                                      .         .         .         .         .         .]
P._capitellatum               GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATTGTCGGCTG   [1223]
P._juniperinum                GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1262]
P._juniperinum_libocedri      GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1262]
P._bolleanum_densum           GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCTAGAGATCGTCGGCTG   [1267]
P._bolleanum_pauciflorum      GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1267]
P._minutifolium               GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1266]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1272]
P._tomentosumM                GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1272]
P._serotinum                  GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1272]
P._tomentosumTX               GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1272]
P._villosum                   GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1266]
P._villosum_coryae            GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTTGGCTG   [1263]
P._scaberrimum                GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1271]
P._galeottii                  GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCTAGAGATCGTCGGCTG   [1264]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 GGGAGAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1263]
P._rhipsalinum                GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCAGCTG   [1262]
P._brachystachyum             GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1262]
P._velutinumSLP               GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1237]
P._velutinumM                 GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1262]
P._forestierae                GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1259]
P._brevifolium                GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCACTCCAGAGATCGTCGGCTG   [1265]
P._reichenbachianum           GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAATCCAGAGATCGTCGGCTG   [1262]
D._guatemalensis              GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCGGCTG   [1230]
P._vernicosum                 GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCAGCTG   [1276]
P._californicum               GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCATTGGCTG   [1276]
P._heydeanum                  GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCTTGTCCAGAGATCGTCAACTG   [1264]
P._tamaulipense               GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAATCCAGAGATCGTCAACTG   [1312]
P._trinervium                 GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAATCCAGAGATCGTCAACTG   [1271]
P._carneum                    GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCAGAGATCGTCAACTG   [1263]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCTGAGATCGTCAACTG   [1246]
P._cf._tonduzii               GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCTGAGATCGTCAACTG   [1246]
P._sulfuratum                 GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAATCCCGAGATCGTCGGCTG   [1223]
D._opuntioides                GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCCGAGATCGTCGGCTG   [1254]
D._domingensis                GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCCGAGATCGTCGGCTG   [990]
D._clavata                    GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCARTCCTGAGATCGTCGGCTG   [1261]
D._costaricensis              GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCCGAGATCGTCGGCTG   [1249]
D._squamigera                 GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCCGAGATCGTCGGCTG   [1257]
P._crassifolium               GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCCGAGATCGTCGGCTG   [1232]
P._piperoides                 GGGAAAAGGATTGGCTCTGAGGGTTGGGCACGGGGGTCCCAGTCCCGAGATCGTCGGCTG   [1232]
Korthalsella_latissima        GGGATAAGGATTGGCTCTGAGGGCTGGGCACGGGGGTCCCACTCCCGAACTCGTCGGCTG   [617]
Acanthosyris_asipapote        GGGAAAAGGATTGGCTCTGAGGGCTGGGCACGGGGGTCCCAGTCTCGAACCCGTCGGCTG   [615]
Thesium_carinatum             GGGAAAAGGATTGGCTCTGAGGGCTGGGCTCGGGGGTCCCAGTCCAGAACCTGTCGTCGG   [613]
[                                      1450      1460      1470      1480      1490      1500]
[                                      .         .         .         .         .         .]
P._capitellatum               TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1283]
P._juniperinum                TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1322]
P._juniperinum_libocedri      TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTTGTTCGGGGG   [1322]
P._bolleanum_densum           TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1327]
P._bolleanum_pauciflorum      TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1327]
P._minutifolium               TCGATGGACTGCTMGAGCTGCTATCGTGGCGAGAGCGGGTTGTTGCGTGTCCTTCGGGGG   [1326]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    CCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1332]
P._tomentosumM                CCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1332]
P._serotinum                  CCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1332]
P._tomentosumTX               CCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1332]
P._villosum                   TTGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTTGCGTGTCGTTTGGGGG   [1326]
P._villosum_coryae            TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1323]
P._scaberrimum                TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1331]
P._galeottii                  TCGACGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCRCGTGTTGTTCGGGGG   [1324]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1323]
P._rhipsalinum                TTGATGGACTGCTCGAGCTGCTGTCGTGGCGAGAGCGGGTTGTCACGTGTTGTTCGGGGG   [1322]
P._brachystachyum             TTGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTATCGCGTGTTGTTCGGGGG   [1322]
P._velutinumSLP               TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1297]
P._velutinumM                 TCGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCGTTCGGGGG   [1322]
P._forestierae                TTGATGAACTGCTTGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTTGTTCGGTGG   [1319]
P._brevifolium                TTGATGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTTGTTCGGGGG   [1325]
P._reichenbachianum           TCGATGGACTGCTTGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTCATTCGGGGG   [1322]
D._guatemalensis              TCGATGGACTGCTTGAGCTGCTATCGTGGCAAGAGCGGGTTGTCGCGTGTTGTTCGGGGG   [1290]
P._vernicosum                 TTGATGGACTGCTTGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTTGTTCGAGGG   [1336]
P._californicum               CTGGTGGACTGCTTGAGCTGCTATCGTGGCGAGAGCGGGTTATCGCGTGTTGTTTGAGGG   [1336]
P._heydeanum                  TTGGTGGACTGCTCGAGCTGCTACCGTTGCGAGAGCGGGTTGCTGCGTGTTGTTTGGGGG   [1324]
P._tamaulipense               TCGGTGGACTGCTTGAGCTGCTATCGTGGCGAGAGCGGGTTGCCGCGTGTTGTTTGGGGG   [1372]
P._trinervium                 TCGGTGGACTGCTTGAGCTGCTTTCGTGGCGAGAGCGGGTTGCCGCGTGTTGTTTGGGGG   [1331]
P._carneum                    TCGGTGGACTGCTTGAGCTGCTCTCGTGGCGAGAGCGGGTTGCCGCGTGTTGTTTGGGGG   [1323]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   TCGGTGGACTGCTTGAGCTGCTATCGTGGCGAGAGCGGGTTGCCGCGTGTTGTTTGGGGG   [1306]
P._cf._tonduzii               TCGGTGGACTGCTTGAGCTGCTATCGTGGCGAGAGCGGGTTGTCGCGTGTTGTTTGGGGG   [1306]
P._sulfuratum                 TCGGCGGACTGCTCGAGCTGCTACCGTGGCGAGAGCGGGTTGCCGCGTGTCGTTCGAGGG   [1283]
D._opuntioides                TCGGCGGACTGCTCGAGCTGCTACCGTGGCGAGAGCGGGTTGCCGCGTGTCGTTCGGGGG   [1314]
D._domingensis                TCGGCGGACTGCTCGAGCTGCTACCGTGGCGAGAGCGGGTTGCCGCGTGTCGTTCGGGGG   [1050]
D._clavata                    TCGGCGGACTGCTCGAGCTGCTACCGTGGCGAGAGCGGGTTGCCGCGTGTCGTTCGGAGG   [1321]
D._costaricensis              CCGACGGACTGCTCGAGCTGCTACCGTGGCGAGAGCGGGTTGCCGCGTGTCGTTCGGAGG   [1309]
D._squamigera                 CCGGCGGACTGCTCGAGCTGCTACCGTGGCGAGAGCGGGTTGCCGCGTGTCGTTCGGAGG   [1317]
P._crassifolium               CCGGCGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGCTGCGTGTCGTTCGGGGG   [1292]
P._piperoides                 CCGGCGGACTGCTCGAGCTGCTATCGTGGCGAGAGCGGGTTGCTGCGTGTCGTTCGGGGG   [1292]
Korthalsella_latissima        TCGTTGAACTGCTCGAGCTGCTCTCGCGGCGAGAGCGGGTCGCCGCGTGTCGTTTGGGGG   [677]
Acanthosyris_asipapote        TCGATGGACTGCTCGAGCTGCTACCGCGGCGAGAGCGGGTCGTCGCGTGCCGACCGGGGG   [675]
Thesium_carinatum             TCGGTGGACTGCTCGAGCTGCTCTCGCGGCGAGAGCGGGTTGCCGCGTG-ATTTCGGGGA   [672]
[                                      1510      1520      1530      1540      1550      1560]
[                                      .         .         .         .         .         .]
P._capitellatum               ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1338]
P._juniperinum                ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1377]
P._juniperinum_libocedri      ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1377]
P._bolleanum_densum           ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1382]
P._bolleanum_pauciflorum      ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1382]
P._minutifolium               ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1381]
P._bolleanum                  ------------------------------------------------------------   [647]
P._tomentosum_macrophyllum    ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1387]
P._tomentosumM                ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1387]
P._serotinum                  ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1387]
P._tomentosumTX               ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1387]
P._villosum                   ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1381]
P._villosum_coryae            ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1378]
P._scaberrimum                ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGTCTC   [1386]
P._galeottii                  ACGGATTGGGAATGGCTCCCTT-----GGGGGCTTTCCTCGGGCATCGAACAATCGACTC   [1379]
P._longifolium                ------------------------------------------------------------   [647]
P._robinsonii                 ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1378]
P._rhipsalinum                ACGGATTCGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATTGAACAATCGACTC   [1377]
P._brachystachyum             ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATTGAACAATCGACTC   [1377]
P._velutinumSLP               ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1352]
P._velutinumM                 ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1377]
P._forestierae                ACGGATTGGGAATGGCTCCCTC-----GGGAGCCTTCCTCGGGCATCGAACAATCGACTC   [1374]
P._brevifolium                ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCCCGGGCATCGAACAATCGACTC   [1380]
P._reichenbachianum           ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATTGAACAATCGACTC   [1377]
D._guatemalensis              ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1345]
P._vernicosum                 ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATCGAACAATCGACTC   [1391]
P._californicum               ACGGATTGGGAATGGCTCCTGC-----TGGGGCCTTCTTCGGGCATTGAACAATCGACTC   [1391]
P._heydeanum                  ACGGATTGGGAATGGCTCCCTT-----GGGGGCCTTCCTCGGGCATGGAACAATTGACTC   [1379]
P._tamaulipense               ACGGATTGGGAATGGCTCCCTT-----GGGGGCCTTCCTCGGGCATGGAACAATTGACTC   [1427]
P._trinervium                 ACGGATTGGGAATGGCTCTCTT-----GGGGGCCTTCCTCGGGCATGGAACAATTGACTC   [1386]
P._carneum                    ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATGGAACAATTGACTC   [1378]
P._robustissimum              ------------------------------------------------------------   [636]
P._nervosum                   ACGGATTGGGAATGGCTCCCTC-----GGGGGCCTTCCTCGGGCATGGAACAATTGACTC   [1361]
P._cf._tonduzii               ACGGATTGGGAATGGCTCCCTT-----GGGGGCCTTCCTCGGGCATGGAACAATTGACTC   [1361]
P._sulfuratum                 ACGGATCGGGAACGGCTCTCTC-----AGGGGCCTTCCTCGGGCATCGAACAACCAACTC   [1338]
D._opuntioides                ACGGATCGGGAACGGCCCTCTC-----GGGGGCCTTCCTCGGGCATCGAACAACCAACTC   [1369]
D._domingensis                ACGGATCGGGAACGGCTCTCTC-----GGGGGCCTTCCTCGTGCGTCGAACGACCAACTC   [1105]
D._clavata                    ACGGATTGGGAACGGCTCTCTC-----GGGGGCCTTCCTCGGGCGTCGAACAACCGACTC   [1376]
D._costaricensis              ACGGATTGGGAACGGCTCTCTC-----GGGGGCCTTCCTCGGGCGTCGAACAACCGACTC   [1364]
D._squamigera                 ACGGATTGGGAACGGCTCTTTC-----GGGGGCCTTCCTCGGGCGTCGAACAATCGACTC   [1372]
P._crassifolium               ACGGATTGGGAACGGCTCTTCC-----GAGGGCCTTCCTCGGGCATCGAACAACCGACTC   [1347]
P._piperoides                 ACGGATTGGGAACGGCTCTTCC-----GAGGGCCTTCCTCGGGCATCGAACAACCGACTC   [1347]
Korthalsella_latissima        ACGGATTGGGAATGGCTCCCCTCTGCGGGGGGCCTTCCTCGGGCATCGAACAGTCGACTC   [737]
Acanthosyris_asipapote        ACGGACTGGGAATGGCTCTTTC-----GGGGGCCTTCCCCGGGCGTCGAACAGTCGACTC   [730]
Thesium_carinatum             ACGGACTGGGAACGGCCCCTCC-----GGGGGCCTTCCCCGGGCAGCGAACAGTCGACTC   [727]
[                                      1570      1580      1590      1600]
[                                      .         .         .         .  ]
P._capitellatum               AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1380]
P._juniperinum                AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1419]
P._juniperinum_libocedri      AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1419]
P._bolleanum_densum           AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1424]
P._bolleanum_pauciflorum      AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1424]
P._minutifolium               AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1423]
P._bolleanum                  ------------------------------------------   [647]
P._tomentosum_macrophyllum    AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1429]
P._tomentosumM                AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAA?   [1429]
P._serotinum                  AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1429]
P._tomentosumTX               AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1429]
P._villosum                   AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1423]
P._villosum_coryae            AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1420]
P._scaberrimum                AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1428]
P._galeottii                  AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1421]
P._longifolium                ------------------------------------------   [647]
P._robinsonii                 AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1420]
P._rhipsalinum                AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1419]
P._brachystachyum             AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1419]
P._velutinumSLP               AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1394]
P._velutinumM                 AGAACTGGTGCGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1419]
P._forestierae                AGAACTGGAACGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1416]
P._brevifolium                AGAACTGGTACGGACTAGGGGAATCCGACTGTTTAATTAAAA   [1422]
P._reichenbachianum           AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1419]
D._guatemalensis              AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAA?   [1387]
P._vernicosum                 AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1433]
P._californicum               AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1433]
P._heydeanum                  AGAACTGGTATGGACAAGGGGAATCCGACTGTTTAATTAAA?   [1421]
P._tamaulipense               AGAACTGGTATGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1469]
P._trinervium                 AGAACTGGTATGGACAAGGGGAATCCGACTGTTTAATTAAA?   [1428]
P._carneum                    AGAACTGGTATGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1420]
P._robustissimum              ------------------------------------------   [636]
P._nervosum                   AGAACTGGTATGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1403]
P._cf._tonduzii               AGAACTGGTATGGACAAGGGGAATCCGACTGTCTAATTAAAA   [1403]
P._sulfuratum                 AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAAT?????   [1380]
D._opuntioides                AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAA??   [1411]
D._domingensis                AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAA?   [1147]
D._clavata                    AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAA?   [1418]
D._costaricensis              AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAA   [1406]
D._squamigera                 AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTA???   [1414]
P._crassifolium               AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAAT?????   [1389]
P._piperoides                 AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAAT?????   [1389]
Korthalsella_latissima        AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAA   [779]
Acanthosyris_asipapote        AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAA   [772]
Thesium_carinatum             AGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAA   [769]
;
END;
CHARSET ITS1=1-291;
CHARSET 5.8S=292-460;
CHARSET ITS2=461-813;
CHARSET D2_region=814-1195;
CHARSET D8_region=1196-1602;
CHARSET ITS=ITS1 5.8S ITS2;
CHARSET 26S=D2_region D8_region;
CHARSET conserved=5.8S D2_region D8_region;
CHARSET D2_domain=955-1192;