#NEXUS 
[Analysis reported in Nickrent, D. L., R. J. Duff, A. E. Colwell, A. D. Wolfe, N. D. Young, K. E. Steiner, and]
[C. W. dePamphilis.  1998.  Molecular Phylogenetic and Evolutionary Studies of Parasitic ]
[Plants. Pp. 211-241 (Chapter 8) In: Molecular Systematics of Plants, Second Edition. D. Soltis,]
[P. Soltis, J. Doyle (eds.).  Chapman and Hall.]
[The 5' and 3' priming sites were zapped]

BEGIN DATA;
DIMENSIONS  NTAX=38 NCHAR=1439;
FORMAT DATATYPE=DNA  MISSING=? GAP=-  INTERLEAVE ;OPTIONS  MSTAXA=UNCERTAIN ;
OPTIONS ZAP="1-30 1405-1439";

MATRIX

[                        10        20        30        40        50        60        70        80        90        100]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATCATACTCCTGACTATGAAACCAAAGATA   [100]
Arceu_ver       ??GTCACCACAAACAGAAACTAAAGCAAGTCTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Dendro_cl       ??GTCACCACAA?CAGAAACTAAAGCAAGTGTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATAAAACCAAAGATA   [100]
Phorad_se       ??????????????????????????????GTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATAAAACCAAAGATA   [100]
Phorad_ca       ????????????????????????????GTGTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGATTATAAAACCAAAGATA   [100]
Korth_lat       ??????????????????????????????GTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATA   [100]
Korth_lin       ?????????????CAGAGACTAAAGCAAGTGTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATA   [100]
Ginalloa        ??????CCACAAACAGAAACTAAAGCAAGTGTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Noto_lei        ?????????????????????????????TGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Noto_sub        ???????????????GAAACTAAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Viscum_al       ?????????????CAGAAACTAAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Viscum_ar       ???????????????????????????????TTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Antidaphn       ????CACCACAAACAGAAACTAAAGCAAGTGTTGGATTCAAAGCTGGGGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Eubrachio       ????????????ACAGAAACTAAAGCAAGTGTTGGATTCAAAGCTGGGGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Lepidocer       ????????????????????????????GTGTTGGATTCAAAGCTGGGGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGAGA   [100]
Osyris          ??????????????????????????????GTTGGATTCAAAGCTGGGGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Comandra        ???????????????????????????????????ATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAGGATA   [100]
Santalum        ??????CCACAAACAGAAACTAAAGCAAGTGTTGGATTCAAAGCTGGGGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGTAACCAAAGATA   [100]
Exocarpos       ????????????????????????????????????TTCAAAGCTGGGGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Pyrularia       ????????????????????TAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Buckleya        ???????????????????CTAAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGATTACGAAACCAAAGATA   [100]
Jodina          ??????CCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Acanthosyris    ???????????????????????????????TTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTTGCAAACCAAAGATA   [100]
Thesium         ????????????????????TAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Agonandra       ?????????????????????????????TGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Cansjera        ????????????????????????????GTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Champerei       ??????????????????????????AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Opilia          ??GTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTAATTATGAAACCAAAGATA   [100]
Misodendr       ????CACCACAAACAGAAACTAAAGCAAGTAGTGGATTCCTAGCTGGTGTTAAAGCGTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]
Gaiadendr       ???TCACCACAAACAGAAACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTATGAAACTAAAGATA   [100]
Moquinell       ??????CCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTATGAAACTAAAGATA   [100]
Tupeia          ???????????????????????????????????????AAAGCCGGTG??AAAGAGTACAAATTGACTTATTATACTCCTGATTATCAAACGAAAGATA   [100]
Strombosi       ??????????????????????????????????????CAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATA   [100]
Minquarti       ?????????????????????????????TGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATA   [100]
Heisteria       ??????????????????????????AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATA   [100]
Ximenia         ???????????????????????????????TTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATA   [100]
Olax            ???????????????????????????????TTGGATTCAAAGCCGGTGTTAAAGATTACAAATTAACTTATTATACTCCGGACTATGAAACTAAAGATA   [100]
Schoepfia       ??????????????????????????????GTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGATTATGAAACCAAAGATA   [100]

[                        110       120       130       140       150       160       170       180       190       200]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           CTGATATCTTGGCAGCGTTCCGAGTAACTCCTCAACCTGGAGTGCCGCCTGAGGAAGCAGGGGCAGCAGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Arceu_ver       CAGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTTCCACCCGAGGAAGCGGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGAC   [200]
Dendro_cl       CAGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCAGCGGAATCTTCTACTGGTACATGGAC   [200]
Phorad_se       CAGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCAGCGGAATCTTCTACTGGTACATGGAC   [200]
Phorad_ca       CAGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCAGCGGAATCTTCGACTGGTACATGGAC   [200]
Korth_lat       CAGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCGACTGGTACATGGAC   [200]
Korth_lin       CAGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCAGCCGAATCTTCTACTGGTACATGGAC   [200]
Ginalloa        CAGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTCGCTGCGGAATCGTCTACTGGTACATGGAC   [200]
Noto_lei        CAGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTGCCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCGGAATCTTCGACTGGTACATGGAC   [200]
Noto_sub        CAGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTGCCACCTGAGGAAGCAGGGGCCGCGGTACGTGCGGAATCTTCGACTGGTACATGGAC   [200]
Viscum_al       CAGATATCTTGGCAGCATTCCGAGTCACTCCTCAGCCAGGAGTTCCGCCTGAGGAAGCAGGGGCCGCCGTAGCTGCGGAATCTTCTACTGGTACATGGAC   [200]
Viscum_ar       CAGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTKCCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCKACTGGTACATGGAC   [200]
Antidaphn       CTGATATCTTGGCAGCATTCCGAGTAACCCCTCAACCTGGAGTTCCACCCGAGGAAGCAGGGGCCGCGGTACGTGCAGAATCTTCTACTGGTACATGGAC   [200]
Eubrachio       CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCCTCTACTGGTACATGGAC   [200]
Lepidocer       CTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Osyris          CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Comandra        CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Santalum        CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Exocarpos       CTGATATCTTGGCAGCATTTCGAGTAACGCCTCAACCAGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Pyrularia       CTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCCGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Buckleya        CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAGGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACCGGTACATGGAC   [200]
Jodina          CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Acanthosyris    CTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Thesium         CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Agonandra       CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCCGAGGAAGCAGGAGCCGCAGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Cansjera        CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCCGAGGAAGCAGGGGCCGCAGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Champerei       CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCCGAGGAAGCAGGAGCCGCAGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Opilia          CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCCGAGGAAGCAGGAGCCGCAGTAGCTGCTGAATCTTCTACTGGTACATGGAC   [200]
Misodendr       CTGATATCTTGGCAGCATTTCGAGTAACTCCCCAACCCGGAGTTCCACCGGAGGAAGCTGGGGCTGCGGTACGTGCCGAATCTTCTACTGGTACATGGAC   [200]
Gaiadendr       CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCAGGGGCCGCGGTACGTGCCGAATCTTCGACTGGTACATGGAC   [200]
Moquinell       CTGATATTTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCAGGAGCCGCGGTAGCTGCCGAATCTTCGACTGGTACATGGAC   [200]
Tupeia          CTGATATCTTGGCAGCATTCCGAGTATCTCCTCAACCTGGAGTTCCACCCGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Strombosi       CTGATCTATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCGGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Minquarti       CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Heisteria       CTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCCCCTGAGGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Ximenia         CTGATCTATTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGAGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGAC   [200]
Olax            CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCAGCAGTAGCAGCGGAATCCTCTACTGGCACATGGAC   [200]
Schoepfia       CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCCGCGGTAGCTGCCGAATCCTCTACTGGTACATGGAC   [200]

[                        210       220       230       240       250       260       270       280       290       300]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           AACTGTGTGGACCGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCAGTTGCTGGAGAAGAAAGTCAATTTATTGCTTAT   [300]
Arceu_ver       CACTGTGTGGACCGATGGACTTACCAATCTGGATCGTTACAAAGGACGATGCTACTACATCGAGTCCGTTGCTGGAGAAAAAAATCAATATATTGCTTAT   [300]
Dendro_cl       CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCAGGAGAAGAAAATCATTTTATTGCTTAT   [300]
Phorad_se       CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGACCGTGGTAGGAGAAGAAAATCAATTTATTGCTTAT   [300]
Phorad_ca       CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCAGGAGAAGAAAATCAATTTATTGCTTAT   [300]
Korth_lat       CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Korth_lin       CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACGATATCGAGCCCGTTGCTGGAGAAGAAAATCAATTTATTGCTTAT   [300]
Ginalloa        CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACGACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTCT   [300]
Noto_lei        CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTGGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Noto_sub        CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTGGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Viscum_al       AACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAACAAACTCAATTTATTGCTTAT   [300]
Viscum_ar       CACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Antidaphn       AACTGTGTGGACCGATGGACTTACCAACCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGAGAAGAAAATCAATTTATTGCATAT   [300]
Eubrachio       AACTGTGTGGACCGACGGACTTACCAACCTTAATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCGTAT   [300]
Lepidocer       AACTGTGTGGACCGACGGACTTACCAACCTTGATCGTTACAAAGGACGATGCTACCACATTGAGCCCGTTACTGGAGAAGAAAATCAATTTATTGCGTAT   [300]
Osyris          AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Comandra        AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Santalum        AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTAT   [300]
Exocarpos       AACTGTGTGGACCGATGGCCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAACCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Pyrularia       AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Buckleya        GACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAGGGCCGATGCTACCACATTGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Jodina          AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Acanthosyris    AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATTTATTGCTTAT   [300]
Thesium         CCCGATGTGGACCGATGGACTTACCAGCCTTGATCGTTATAAAGCGCGATGCTACCATCTCAGGCCCGTTGCTGGAGAAGAAAATCAATTTATTGCTTAT   [300]
Agonandra       AACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTATAAAGGACGGTGCTACCACATCGAACCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Cansjera        AACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTATAAAGGACGGTGCTACCACATCGAACCTGTTGCTGGAGAAGAAACTCAATTCATTGCTTAT   [300]
Champerei       AACCGTGTGGACCGATGGACTTACCAGCCTTGATCGTTATAAAGGACGGTGCTACCACATCGAACCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Opilia          AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTATAAAGGACGGTGCTACGACATCGAACCCGTTGCTGGAGAAGAAAATCAATACATTGTTTAT   [300]
Misodendr       AACGGTGTGGACCGATGGACTTACCAGCCTTGATCGTTATAAAGGCCGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATCGCTTAT   [300]
Gaiadendr       CACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Moquinell       CACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATCTTGCTTAT   [300]
Tupeia          CACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTATGAAATCGAGCCCGTTGCTGGAGAGGAAAATCAATATATTGCTTAT   [300]
Strombosi       AACTGTGTGGACCGATGGACTTACCAGCCTGGATCGTTACAAAGGACGATGCTACCACATCGAGGCCGTTGTTGGAGAAGACAATCAATATATTGCTTAT   [300]
Minquarti       AACTGTGTGGACCGATGGACTTACCAGCCTTGACCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAATCAATATATTGCTTAT   [300]
Heisteria       AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAAGTCAATTTATTGCTTAT   [300]
Ximenia         AACTGTGTGGACTGACGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGAGAAGAAACTCAATTTATTGCTTAT   [300]
Olax            AACTGTGTGGACCGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTACCATATCGAGCCCGTCGCTGGAGAAGAAAATCAATTTATTGCTTAT   [300]
Schoepfia       AACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTATAAAGGAAGATGCTACCACATTGAGCCCGTTGCTGGCGAAGAAAATCAATATATTGCTTAT   [300]

[                        310       320       330       340       350       360       370       380       390       400]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAGGCCCTGCGTGCTCTAC   [400]
Arceu_ver       GTGGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGGTTTAAAGCCCTGCGTGCTCTAC   [400]
Dendro_cl       GTTGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCCTGCGTGCTCTAC   [400]
Phorad_se       GTGGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTGTTTGGGTTTAAAGCCCTGCGTGCTCTAC   [400]
Phorad_ca       GTGGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTGTTTGGGTTTAAAGCCCTGCGTGCTCTAC   [400]
Korth_lat       GTCGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTGACTTCGATTGTTGGTAATGTATTTGGGTTCAAAGCCTTGCGTGCTCTAC   [400]
Korth_lin       GTCGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTGACTTCTATTGTTGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTAC   [400]
Ginalloa        GTCGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTGACTTCTATTGTTGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTAC   [400]
Noto_lei        GTCGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTTTAC   [400]
Noto_sub        GTCGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTTTAC   [400]
Viscum_al       GTCGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGCTCAAAGCCCTGCGTGCTCTAC   [400]
Viscum_ar       GTCGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGCTCAAAGCCCTGCGTGCTCTAC   [400]
Antidaphn       GTGGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTTTTTGGGTTCAAAGCCCTGCGTGCTCTAA   [400]
Eubrachio       GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCAGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTAA   [400]
Lepidocer       GTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTAA   [400]
Osyris          GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTGTTTGGGTTCAAAGCCCTGCGTGCTCTAA   [400]
Comandra        GTAGCTTACCCCTTAGACCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTCTTTGGGTTCAAAGCCCTGCGTGCTCTCC   [400]
Santalum        GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGCAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTAA   [400]
Exocarpos       GTAGCTTATCCCTTAGACCTTTTTGAAGAAGGATCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCTTGCGTGCTCTAC   [400]
Pyrularia       GTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTCCGGTTCAAAGCCTTGCGTGCTCTAC   [400]
Buckleya        GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTCGTATCAACAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGTGCTCTAC   [400]
Jodina          GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCTTGCGTGCTCTAC   [400]
Acanthosyris    GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCTTGCGTGCTCTAC   [400]
Thesium         GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTAC   [400]
Agonandra       GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTAC   [400]
Cansjera        GTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAACCGTGCGTGCTCTAC   [400]
Champerei       GTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTAC   [400]
Opilia          GTAGCTTACCCCTTAGATCTTTTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTAC   [400]
Misodendr       GTAGCTTATCCCCTAGACCTTTTTGAAGAAGGGTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCCCTAC   [400]
Gaiadendr       GTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTTAAAGCCCTACGTGCTCTAC   [400]
Moquinell       GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGTTTTAAAGCCCTACGTGCTCTAC   [400]
Tupeia          GTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTTGGTAATGTATTTGGGTTTAAAGCTCTACGTGCTCTAC   [400]
Strombosi       GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTAC   [400]
Minquarti       GTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTAC   [400]
Heisteria       GTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTAC   [400]
Ximenia         GTAGCTTACCCTTTAGACCTTTTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTTCGCGCTCTAC   [400]
Olax            GTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTACGCGCTCTAC   [400]
Schoepfia       GTCGCTTATCCCTTAGACCTTTTTGAAGAAGGCTCTGTTACTAACATGTTGACTTCCATTGTCGGTAATGTATTTGGGTTTAAAGCCTTGCGTGCCCTGC   [400]

[                        410       420       430       440       450       460       470       480       490       500]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           GTCTGGAGGATTTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTAAACAAGTATGGCCG   [500]
Arceu_ver       GTCTGGAGGATCTGCGAATACCTCCAGCTTATTGTAAAACTTTTCAAGGACCACCTCATGGCATTCAAGTCGAGAGAGATAAATTGAACAAATATGGTCG   [500]
Dendro_cl       GTCTGGAGGATCTGCGAATCCCTCCAGCTTATTCTAAAACTTTTCAAGGCCCACCTCATGGCATTCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Phorad_se       GTCTGGAGGATCTGCGAATACCTCCAGCTTATTCGAAAACTTTTCAAGGCCCACCTCATGGCATTCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Phorad_ca       GTCTGGAAGATCTGCGAATACCTCCAGCTTATTCGAAAACTTTTCAAGGCCCACCTCATGGCATTCAAGTGGAGAGAGATAAATTGAATAAGTATGGTCG   [500]
Korth_lat       GTCTGGAGGATCTGCGAATCCCTCCAGCTTATTCGAAAACTTTTCAAGGCCCACCTCATGGCATTCAAGTGGAGAGAGATAACTTGAACAAGTATGGTCG   [500]
Korth_lin       GTCTGGAGGATCTGCGAATCCCTCCAGCTTATTCGAAAACTTTTCAAGGCCCACCTCATGGCATTCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Ginalloa        GTCTGGAGGATCTGCGAATCCCTCCAGCTTAT-TCAAAACTTTCCAAGGCCCACCTCATGCATTCCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCG   [499]
Noto_lei        GTCTGGAGGATCTGCGAATTCCTCCAGCTTATTCGAAAACTTTTCAAGGCCCACCTCATGGTATTCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Noto_sub        GTCTGGAAGGTCTGCGAATTCCTCCAGCTTATTCGAAAACTTTTCAAGGCCCACCTCATGGTATTCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Viscum_al       GGCTGGAAGGTCTGCGAATTCCTCCAGCTTATTCTAAAACTTTTCAAGGACCACCTCATGGCATTCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Viscum_ar       GTCTGGAGGATCTGCGAATTCCTCCAGCTTATTCGAAAACTTTTCAAGGCCCACCTCATGGTATTCAAGTGGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Antidaphn       GGCTGGAGGATCTGCGAATCCCTCCTGCTTATTCAAAAACTTTTCAAGGTCCACCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Eubrachio       GGCTGGAGGATTTGCGAATCCCTCCTGCTTATTCTAAAACTTTTCAAGGACCACCTCATGGCATCCAAGTCGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Lepidocer       GGCTGGAGGATTTGCGAATCCCTCCAGCTTATTCTAAAACTTTTCAAGGACCACCTCATGGCATCCAAGTCGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Osyris          GGTTGGAGGATCTGCGAATCCCTCCTGCTTAT?CTAAAACTTTTCAAGGCCCACCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Comandra        GGTTGGAGGATCTGCGAATCCCTCCTGCTTATCTTAAAACTTTCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Santalum        GGCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTTCAAGGCCCACCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACG   [500]
Exocarpos       GGTTAGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTTCAAGGACCACCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Pyrularia       GGCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGACCTCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGCCG   [500]
Buckleya        GGCTAGAGGATCTCCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGCCCCCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCG   [500]
Jodina          GGCTGGAGGATCTGCGAATACCCCCTGCTTATTCTAAAACTTTCCAAGGCCCACCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACG   [500]
Acanthosyris    GGCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGCCCACCTCATGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Thesium         GGCTGGAGGATCTGCGAATTCCTCCTGCTTATTCTAAAACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCG   [500]
Agonandra       GGCTGGAAGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCTTCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Cansjera        GGCTGGAGGATCTGCGAGTCCCTCCTGCTTATTCTAAAACTTTCCAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Champerei       GGCTGGAGGATCTGCGAGTCCCTCCAGCTTATTCTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Opilia          GGCTCGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTCGAAGGTCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCC   [500]
Misodendr       GTTTGGAGGATCTGAGAATCCCTCCTGCTTATGCTAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGCCG   [500]
Gaiadendr       GTCTGGAGGATCTTAGAATCCCCCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Moquinell       GTCTGGAAGATCTTCGAATCCCCCCGGCTTATTCTAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAGTTGAACAAGTACGGCCG   [500]
Tupeia          GTCTGGAAGATCTTCGAATCCCCCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Strombosi       GTCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Minquarti       GTCTGGAGGATCTGCGAATCCCTCCTGCTTATACTAAAACTTTCCAAGGTCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Heisteria       GTCTGGAGGATCTGCGAATCCCTCCTGCTTATTCTAAAACTTTCCAAGGTCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Ximenia         GTTTGGAGGATCTGCGAATTCCTCCTGCTTATTCTAAAACTTTTCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]
Olax            GTCTAGAGGATCTGCGAGTCCCTCCTGCTTATTCTAAAACTTTCCAAGGTCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCG   [500]
Schoepfia       GTTTAGAGGATCTGAGAATCCCCCCTGCTTATTCTAAAACGTTCCAAGGCCCACCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG   [500]

[                        510       520       530       540       550       560       570       580       590       600]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           CCCCCTATTGGGATGTACTATTAAGCCTAAATTGGGATTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTCCGCGGTGGGCTTGATTTTACC   [600]
Arceu_ver       TCCCCTATTGGGATGTACAATTAAACCAAAATTGGGATTATATGCTAAGAACTACGGTAGAGCCGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACA   [600]
Dendro_cl       TCCCCTATTGGGATGTACAATAAAACCTAAATTGGGGTTATCTGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACA   [600]
Phorad_se       TCCCCTATTGGGATGTACAATAAAACCTAAATTGGGGTTATCTGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACA   [600]
Phorad_ca       TCCCCTATTGGGATGTACAATAAAACCTAAATTGGGGTTATCTGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACA   [600]
Korth_lat       TCCCCTATTGGGATGTACAATTAAACCTAAATTGGGGTTATCTGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACA   [600]
Korth_lin       TCCCCTATTGGGATGTACAATTAAACCTAAATTGGGGTTATCTGCGAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACA   [600]
Ginalloa        TCCCCTATTGGGATGCACAATTAAACCTAAATTGGGGTTATCTGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACA   [599]
Noto_lei        TCCCCTATTGGGATGTACAATTAAACCTAAATTGGGGTTATCTGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACA   [600]
Noto_sub        TCCCCTATTGGGATGTACAATTAAACCTAAATTGGGGTTATCTGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACA   [600]
Viscum_al       TCCCCTATTGGGATGTACAATTAAACCTAAATTAGGATTATCTGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACA   [600]
Viscum_ar       TCCCCTATTGGGATGTACAATTAAACCTAAATTGGGGTTATCTGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACA   [600]
Antidaphn       TCCATTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCTGCTAAGAACTATGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Eubrachio       TCCATTATTGGGATGTACTATTAAACCTAAATTGGGATTATCTGCTAAGAACTATGGTAGGGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Lepidocer       TCCATTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCTAAGAACTATGGTAGAGCGGTTTATGAATGTCTTCGCGGCGGACTTGATTTTACC   [600]
Osyris          TCCATTATTGGGATGTACTATTAAACCCAAATTGGGGTTATCCGCTAAGAACTATGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Comandra        TCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGCGGACTTGATTTTACC   [600]
Santalum        TCCGTTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTATGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Exocarpos       TCCATTATTGGGATGTACTATTAAACCCAAATTGGGGTTATCTGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Pyrularia       TCCACTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCGGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Buckleya        TCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Jodina          ACCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCCAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Acanthosyris    ACCCCTATTGGGATGTACTATTAAACCGAAATTGGGGTTATCCGCCAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Thesium         TCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGGGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACC   [600]
Agonandra       CCCCCTATTGGGATGTACTATTAAACCTAAATTAGGGTTATCTGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACT   [600]
Cansjera        CCCCCTATTGGGATGTACTATTAAACCTAAATTAGGGTTATCTGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACT   [600]
Champerei       CCCCCTATTGGGATGTACTATTAAACCTAAATTAGGGTTATCTGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACT   [600]
Opilia          GCCCCCATTGGGATGTACTATTAAACCTAAATTAGGGTTATCTGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTTCGCGGTGGACTTGATTTTACT   [600]
Misodendr       TCCCCTATTGGGATGTACTATTAAACCTAAATTAGGGTTATCCGCTAAAAACTATGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACC   [600]
Gaiadendr       TCCTCTATTGGGATGTACTATTAAACCCAAATTGGGGTTATCCGCTAAGAACTACGGTCGAGCGGTTTATGAGTGTCTTCGCGGTGGACTTGATTTTACC   [600]
Moquinell       TCCTCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCTAAGAACTACGGTCGAGCGGTTTATGAGTGTCTTCGTGGTGGACTTGATTTTACC   [600]
Tupeia          TCCTCTATTGGGATGTACTATTAAACCCAAATTGGGGTTATCCGCTAAGAACTACGGTCGAGCGGTTTATGAGTGTCTTCGTGGTGGACTTGATTTTACC   [600]
Strombosi       TCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTCCGCGGGGGACTTGATTTTACC   [600]
Minquarti       TCCTCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACC   [600]
Heisteria       TCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACC   [600]
Ximenia         CCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAGAATTACGGTAGAGCAGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACC   [600]
Olax            TCCCTTATTGGGATGCACTATTAAACCTAAGTTGGGATTATCTGCTAAGAATTATGGTAGAGCCGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACC   [600]
Schoepfia       TCCCCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCTAAAAACTATGGCCGAGCGGTTTATGAATGCCTTCGCGGTGGACTTGATTTTACC   [600]

[                        610       620       630       640       650       660       670       680       690       700]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           AAAGATGATGAGAACGTGAATTCCCAACCATTTATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAAGCGCAGGCTGAAACAGGTG   [700]
Arceu_ver       AAAGATGATGAGAACGTAAATTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTG   [700]
Dendro_cl       AAAGATGATGAGAACGTAAATTCCCAACCTTTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Phorad_se       AAAGATGATGAGAACGTAAATTCCCAACCTTTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTTATAAAGCACAGGCGGAAACAGGCG   [700]
Phorad_ca       AAAGATGATGAGAACGTCAATTCCCAACCTTTTATGCGTTGGAGAGACCGTTTCGTTTTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Korth_lat       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Korth_lin       AAAGATGATGAGAAYGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTCATAAAGCACAGGCCGAAACAGGYG   [700]
Ginalloa        AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCGTATWTTGTGCCGAAGCCATTTATAAAGCACAGGCCGAAACAGGCG   [699]
Noto_lei        AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCAATTGATAAAGCACAGGCCGAAACAGGCG   [700]
Noto_sub        AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCAATTGATAAAGCACAGGCCGAAACAGGCG   [700]
Viscum_al       AAAGATGATGAGAACGTCAATTCCCAACCATTTATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAAGCTGAAACAGGTG   [700]
Viscum_ar       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTG   [700]
Antidaphn       AAAGATGATGAGAACGTAAACTCTCAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCCATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Eubrachio       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Lepidocer       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Osyris          AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Comandra        AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTG   [700]
Santalum        AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAGGCACAGGCCGAAACAGGTG   [700]
Exocarpos       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Pyrularia       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACGGGCG   [700]
Buckleya        AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCATTTATAAAGCACAGGCCGAAACAGGCG   [700]
Jodina          AAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGCG   [700]
Acanthosyris    AAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAAGCACAGGCCGAAACGGGCG   [700]
Thesium         AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGCGCCGAAGCCATTTATAAAGCACAGGCTGAAACAGGCG   [700]
Agonandra       AAAGATGATGAAAACGTGAACTCCCAACCATTCATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCCCTTTACAAAGCACAGGCAGAAACAGGTG   [700]
Cansjera        AAAGATGATGAGAACGTAAACTCCCAACCATTCATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCCATTTACAAAGCACAAGCAGAAACAGGCG   [700]
Champerei       AAAGATGATGAGAACGTAAACTCCCAACCATTCATGCGTTGGAGAGATCGTTTCGTATTTTGTGCCGAAGCCATTTACAAAGCACAAGCCGAAACAGGCG   [700]
Opilia          AAAGATGATGAGAACGTAAACTCCCAACCATTCATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCCCTTTACAAAGCACAGGCAGAAACAGGTG   [700]
Misodendr       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGCG   [700]
Gaiadendr       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCACAGGCCGAAACTGGCG   [700]
Moquinell       AAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGYTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCACAGGCCGAAACTGGCG   [700]
Tupeia          AAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTCTTTATAAAGCACAGGCCGAAACTGGCG   [700]
Strombosi       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCTGAAGCACTTTATAAAGCACAGGCCGAAACAGGTG   [700]
Minquarti       AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTG   [700]
Heisteria       AAAGATGATGAGAATGTAAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCCGAAACAGGTG   [700]
Ximenia         AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTG   [700]
Olax            AAAGATGATGAGAACGTAAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACAGGTG   [700]
Schoepfia       AAAGATGATGAGAACGTAAACTCTCAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCCATTTTTAAAGCACAGGCCGAAACAGGTG   [700]

[                        710       720       730       740       750       760       770       780       790       800]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Arceu_ver       AAGTAAAAGGACATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGGGCTATATTTGCCCGAGAATTAGGAGTTTCAATCATAATGCA   [800]
Dendro_cl       AAATCAAAGGGCATTACTTAAATGCTACGGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTTTTTGCCAGAGAATTAGGAGTCCCAATCATAATGCA   [800]
Phorad_se       AAATCAAAGGGCATTACTTAAATGCTACGGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTTTTTGCCAGAGAATTAGGAGTCCCAATCATAATGCA   [800]
Phorad_ca       AAATAAAAGGGCATTACTTAAATGCTACGGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTTTTTGCCAGAGAATTAGGAGTCCCAATCATAATGCA   [800]
Korth_lat       AAATAAAAGGGCATTACTTAAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTAGGAGTACCAATCATAATGCA   [800]
Korth_lin       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACTTGCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAATTAGGAGTCCCAATCATAATGCA   [800]
Ginalloa        AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGACCAAAAGGGCTGTCTTTGCCAGAGAATTAGGAGTACCAATCATAATGCA   [799]
Noto_lei        AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCCAGAGAATTAGGAGTTCCAATCGTAATGCA   [800]
Noto_sub        AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCCAGAGAATTAGGAGTTCCAATCGTAATGCA   [800]
Viscum_al       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCTGTTTTTGCCAGAGAATTAGGAGTTCCAATAGTCATGCA   [800]
Viscum_ar       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGAGCTGTATTTGCCAGAGAATTAGGAGTTCCCATCGTAATGCA   [800]
Antidaphn       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Eubrachio       AAATAAAAGGTCATTACTTGAATGCTACTGCAGCGACATGCGAAGAAATGATCAAAAGGGCTGTATTTGCAAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Lepidocer       AAATTAAAGGGCATTACTTGAATGCTACTGCGGCTACATGCGAAGAAATGATTCAAAGGGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Osyris          AAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACGTGCGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Comandra        AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGGGCCGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Santalum        AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Exocarpos       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGGGCTGTATGTGCGAGGGAATTGGGAGTTCCTATCGTAATGCA   [800]
Pyrularia       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGCGAAGAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Buckleya        AAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACATGCGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Jodina          AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGAGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Acanthosyris    AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGGGCTGTATTTGCTAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Thesium         AAATCAAAGGGCATTATTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCCAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Agonandra       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Cansjera        AAATCAAAGGGCATTACTTGAATGCTACTGCGGGTACATGTGAAGAAATGATCAAAAGGGCTGTATGTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Champerei       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Opilia          AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGGGCTGCATGTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Misodendr       AAATCAAAGGACATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTTTTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCA   [800]
Gaiadendr       AAATCAAAGGGCATTATTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCA   [800]
Moquinell       AAATCAAAGGTCATTATTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCA   [800]
Tupeia          AAATCAAAGGTCATTATTTGAATGCTACTGCAGGTACATGCGAAGAAATGATAAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTCCCTATCGTAATGCA   [800]
Strombosi       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCCAGAGAATTGGGAACTCCTATCGTAATGCA   [800]
Minquarti       AAATCAAAGGGCATTACTACAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Heisteria       AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAACGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Ximenia         AAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCGTAATGCA   [800]
Olax            AAATCAAGGGACATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCCAGAGAATTGGGAGTTCCTATCCTAATGCA   [800]
Schoepfia       AAATCAAAGGGCATTACTTGAATGCTACGGCAGGTACATGGGAAGAAATGCTCAAAAGGGCTGTATGTGCCAGAGAGTTGGGAGTCCCTATCATAATGCA   [800]

[                        810       820       830       840       850       860       870       880       890       900]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           TGACTACTTAACCGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCATCGTGCAATGCATGCAGTT   [900]
Arceu_ver       TGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGTCGAGGGAATGGCCTACTTCTTCACATCCATCGTGCCATGCATGCGGTA   [900]
Dendro_cl       TGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCAGTT   [900]
Phorad_se       TGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCAGTT   [900]
Phorad_ca       TGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCAGTT   [900]
Korth_lat       TGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Korth_lin       TGACTACTTAACAGGTGGATTCACTGCAAATACTAGTTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Ginalloa        TGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [899]
Noto_lei        TGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATCCGGTA   [900]
Noto_sub        TGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTA   [900]
Viscum_al       TGACTATTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTA   [900]
Viscum_ar       TGACTACTTAACAGGTGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTA   [900]
Antidaphn       TGACTACTTAACAGGAGGATTCACGGCAAATACAAGCTTGTCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Eubrachio       TGATTATTTAACGGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCATCGTGCAATGCATGCGGTT   [900]
Lepidocer       TGACTACTTAACGGGGGGATTCACTGCAAATACTAGCTTGTCTCATTATTGCCGAAATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Osyris          TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCATGCGGTT   [900]
Comandra        TGACTACTTAACCGGAGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Santalum        TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Exocarpos       TGACTACTTAACAGGGGGATTTACTGCAAATACTAGCTTGGCTCATTATTGTCGAGATAATGGCCTACTTCTTCACATACATCGTGCAATGCATGCGGTT   [900]
Pyrularia       TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Buckleya        TGACTACTTAACGGGGGGATTCACTGCAAATACTAGTTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Jodina          TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Acanthosyris    TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Thesium         TGACTATTTAACGGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Agonandra       TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTAGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATCCATCGTGCAATGCACGCGGTT   [900]
Cansjera        TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTAGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATCCATCGTGCAATGCACGCGGTT   [900]
Champerei       TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTAGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATCCATCGTGCAATGCACGCGGTT   [900]
Opilia          TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTAGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATCCATCGTGCAATGCACGCGGTT   [900]
Misodendr       TGATTACATAACAGGAGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCTTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Gaiadendr       TGACTATTTAACAGGGGGTTTCACTGCAAATACTAGCTTGGCTCATTATTGCCGGGATAATGGCTTACTTCTTCATATCCATCGTGCAATGCATGCGGTT   [900]
Moquinell       TGACTATTTAACAGGGGGATTTACTGCAAATACTAGCTTGGCTCATTATTGCCGGGATAATGGYTTACTTCTTCATATCCATCGTGCAATGCAYGCGGTT   [900]
Tupeia          TGACTATTTAACAGGGGGATTTACTGCAAATACTAGCTTGGCTCATTATTGCCGGGATAATGGCTTACTTCTTCATATCCATCGTGCAATGCACGCGGTT   [900]
Strombosi       TGATTACTTAACAGGAGGATTTACTGCAAATACTAGCTTGGCTCATTATTGCCGGGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Minquarti       TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTGCTTCTTCACATTCATCGTGCAATGCATGCGGTT   [900]
Heisteria       TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Ximenia         TGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCTTGCTTCTTCACATCCATCGTGCAATGCATGCGGTT   [900]
Olax            TGACTACTTAACAGGGGGATTTACTGCAAATACGAGCTTGGCTCATTATTGCCGAGATAATGGCCTTCTTCTTCATATCCATCGTGCAATGCATGCGGTT   [900]
Schoepfia       TGACTACTTAACAGGAGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCTTACTTCTGCACATCCATCGTGCAATGCATGCGGTT   [900]

[                        910       920       930       940       950       960       970       980       990       1000]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           ATTGATAGACAGAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACGCGGGTACCGTAGTAGGTA   [1000]
Arceu_ver       ATTGATAGACAAAAAAATCATGGGATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGGGATCATATTCACTCAGGTACTGTTGTAGGTA   [1000]
Dendro_cl       ATTGATAGACAAAAAAATCATGGGATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACTGTTGTAGGTA   [1000]
Phorad_se       ATTGATAGACAAAAAAATCATGGGATACACTTTCGTGTACTAGCGAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACTGTTGTAGGTA   [1000]
Phorad_ca       ATTGATAGACAAAAAAATCATGGGATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCGGGTGGAGATCATATTCACGCAGGTACTGTTGTAGGTA   [1000]
Korth_lat       CTTGATAGACAAAAGAATCATGGGATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACTGTTGTAGGTA   [1000]
Korth_lin       ATTGATAGACAAAAGAATCATGGGATACACTTTCGTGTACTAGCGAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACTGTTGTAGGTA   [1000]
Ginalloa        CTTGATAGACAAAAGAATCATGGGATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCAGGTACTGTTGTAGGTA   [999]
Noto_lei        ATTGATAGACAAAAGAATCATGGGATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCATGCAGGTACTGTTGTAGGTA   [1000]
Noto_sub        ATTGATAGACAAAAGAATCATGGGATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCATGCAGGTACTGTTGTAGGTA   [1000]
Viscum_al       ATTGATAGACAAAAGAATCATGGAATGCACTTTCGTGTACTCGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCAGGTACTGTTGTAGGTA   [1000]
Viscum_ar       ATTGATAGACAAAAGAATCATGGGATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCATGCAGGTACTGTTGTAGGTA   [1000]
Antidaphn       ATTGATAGACAAAAGAATCATGGTATCCACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACGGTAGTGGGGA   [1000]
Eubrachio       ATTGATAGACAAAAAAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]
Lepidocer       ATTGATAGACAAAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATCCACTCTGGTACTGTAGTAGGGA   [1000]
Osyris          ATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTATTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGGA   [1000]
Comandra        ATTGATAGACAAAAGAATCATGGTATACACTTCCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]
Santalum        ATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGGA   [1000]
Exocarpos       ATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATGTTCACGCTGGTACTGTAGTAGGGA   [1000]
Pyrularia       ATTGATAGACAAAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCGGGTACTGTAGTAGGTA   [1000]
Buckleya        ATTGATAGACAAAAGAATCATGGTATACACTTTCGTGTATTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTCGTAGGTA   [1000]
Jodina          ATTGATAGACAAAAGAATCATGGTATAGAGTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGGGGAGATCATATTCACGCGGGTACTGTAGTAGGTA   [1000]
Acanthosyris    ATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGGGGAGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]
Thesium         ATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTATTAGCTAAAAGTTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTAGTAGGTA   [1000]
Agonandra       ATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]
Cansjera        ATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]
Champerei       ATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]
Opilia          ATTGATAGACAAAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTACGTCTGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]
Misodendr       ATTGATAGACAAAAGAATCACGGTATACACTTTCGTGTATTAGCTAAAGCCTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTAGTAGGTA   [1000]
Gaiadendr       ATTGATAGACAAAAAAATCATGGTATACACTTTCGTGTATTAGCTAAAGCCTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTAGTAGGTA   [1000]
Moquinell       ATTGATAGACAAAAAAATCATGGTATACACTTTCGTGTATTAGCTAAAGCCTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTAGTAGGTA   [1000]
Tupeia          ATTGATAGACAAAAAAATCATGGTATACACTTTCGTGTATTAGCTAAAGCCTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACTGTAGTAGGTA   [1000]
Strombosi       ATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCGGTACGTATGTCTGGTGGAGATCATGTTCACGCTGGTACCGTAGTAGGTA   [1000]
Minquarti       ATTGATAGACAGAAGAATCATGGTATACACTTTCGTGTACTAGCTAAAGCCTTACGTATGTCTGGTGGCGATCATATTCACGGCGGTACCGTAGTAGGTA   [1000]
Heisteria       ATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCGTTACGTATGTCTGGCGGAGATCATGTTCACGCTGGTACCGTAGTAGGTA   [1000]
Ximenia         ATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCCTTACGTCTGTCTGGTGGAGATCATATTCACGCTGGTACCGTAGTAGGTA   [1000]
Olax            ATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCCTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]
Schoepfia       ATTGATAGACAAAAGAATCATGGTATACACTTTCGTGTCCTAGCTAAAGCTTTACGTATGTCTGGTGGGGATCATATTCACGCTGGTACTGTAGTAGGTA   [1000]

[                        1010      1020      1030      1040      1050      1060      1070      1080      1090      1100]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           AACTTGAAGGGGAAAGAGAGATCACTTTAGGCTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGATCGAAGCCGCGGTATTTATTTCACTCAAGA   [1100]
Arceu_ver       AACTGGAAGGGGAAAGAGACATTACTTTGGGATTTGTTGATTTACTACGAGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAAA   [1100]
Dendro_cl       AACTGGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGAGATGATTTTATTGCAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Phorad_se       AACTGGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTGCTACGAGATGATTTTATTGCAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Phorad_ca       AACTGGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGAGATGATTTTATTGCAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Korth_lat       AACTGGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGAGATGATTTTATTGAAAAAGACCGATCTCGTGGTATTTATTTCACTCAAGA   [1100]
Korth_lin       AACTAGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGAGATGATTTTATTGAAAAAGACCGATCTCGTGGTATTTATTTCACTCAAGA   [1100]
Ginalloa        AACTGGAAGGGGAAAGATACATCACTTTGGGATTTGTTGATTTAC?ACGAGATGATTTTATTGAAAAAGACCGATCTCGTGGTATTTATTTCACTCAAGA   [1099]
Noto_lei        AACCTGGAGGGGAAAGAGGCATTACTTTGGGATTTGTTGATTTACTACGAGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Noto_sub        AACTGGAGGGGGAAAGAGGCATTACTTTGGGCTTTGTTGATTTACTACGAGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Viscum_al       AATTGGAAGGGGAAAGAGACATCACTTTGGGGTTTGTTGATTTACTACGAGATGATTTTATTGAAAAAGACCGAAGTCGTGGGATTTATTTCACTCAAGA   [1100]
Viscum_ar       AACTTGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGAGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Antidaphn       AGCTTGAGGGGGAAAGAGAAATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Eubrachio       AACTTGAAGGGGAAAGAGAAATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Lepidocer       AACTTGAAGGGGAAAGAGAAATAACTTTGGGATTTGTTGATTTACTACGTGATGATTTGATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Osyris          AACTTGAAGGGGAAAGAGAAATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGA   [1100]
Comandra        AACTTGAGGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAGA   [1100]
Santalum        AACTCGAAGGGGAAAGAGAGATTACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Exocarpos       AACTTGAAGGGGAAAGAGAAATAACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGGATTTATTTCACTCAAGA   [1100]
Pyrularia       AACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTACTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAGGA   [1100]
Buckleya        AACTTGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAGA   [1100]
Jodina          AACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTACTACGCGATGATTTTGTTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Acanthosyris    AACTTGAAGGCGAAAGAGACATTACTTTGGGATTTGTTGATTTACTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Thesium         AACTTGAAGGGGAAAGAGATATCACTTTGGGATTTGTTGATTTACTACGCGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGA   [1100]
Agonandra       AACTTGAAGGGGAACGAGACATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Cansjera        AACTTGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Champerei       AACTTGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Opilia          AACTTGAAGGGGAAAGAGACATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Misodendr       AACTTGAAGGGGAAAGAGATATCACTTTGGGTTTTGTTGATTTATTACGTGATGATTTTATTGAAAAAGATAGAAGTCGCGGTATTTTTTTCACCCAAGA   [1100]
Gaiadendr       AACTTGAAGGGGAAAGAGATATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAAACCGAAGTAAGGGGATTTATTTCACTCAAGA   [1100]
Moquinell       AACTTGAAGGTGAAAGAGATATCACTTTGGGATTTGTTGATTTACTACGTGATGATTTTATTGAAAAAAACCGAAGTAAGGGGATCTATTTCACTCAAGA   [1100]
Tupeia          AACTTGAAGGGGAAAGAGATATCACTTTGGGATTTGTTGTTTTACTACGTGATGATTTTATTGAAAAAAACCGAAGTAAGGGGATCTATTTCACTCAAGA   [1100]
Strombosi       AACTTGAAGGGGAACGAGACATCACTTTGGGCTTTGTTGATTTACTACGTGATGATTATATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Minquarti       AACTTGAAGGGGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Heisteria       AACTTGAAGGGGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Ximenia         AACTTGAAGGGGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Olax            AACTTGAGGGTGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTACGTGATGATTTTATTGAAAAAGATCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]
Schoepfia       AACTTGAAGGGGAAAGAGACATCACTTTGGGCTTTGTTGATTTATTACGTGATGATTTTGTTGAAAAAGATCGAAGTCGCGGTATTTATTTCACTCAAGA   [1100]

[                        1110      1120      1130      1140      1150      1160      1170      1180      1190      1200]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           TTGGGTCTCTCTACCTGGTGTTCTGCCCGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAAATCTTTGGAGATGATTCCGTACTA   [1200]
Arceu_ver       TTGGGTGTCGCTACCAGGTCTTTTACCCGTTGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGATATTTTTGGGGATGATTCCGTACTA   [1200]
Dendro_cl       TTGGGTATCGCTACCAGGTGTTTTGCCCGTCGCTTCGGGCGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCTGTACTA   [1200]
Phorad_se       TTGGGTGTCGCTACCAGGTGTTTTGCCCGTCGCTTCGGGCGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCTGTACTA   [1200]
Phorad_ca       TTGGGTGTCGCTACCAGGTGTTTTGCCCGTCGCTTCGGGCGGTATTCATGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGATGATTCTGTACTA   [1200]
Korth_lat       TTGGGTGTCACTACCAGGTGTTTTGCCCGTCGCTTCGGGGGGGATTCATGTTTGGCATATGCCTGCTCTGACCGAAATATTTGGGGATGATTCTGTACTA   [1200]
Korth_lin       TTGGGTGTCACTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGGATTCATGTTTGGCATATGCCTGCTCTGACCGAGATATTTGGGGATGATTCCGTACTA   [1200]
Ginalloa        TTGGGTGTCACTACCAGGTGTTTTGCCCGTCGCTTCGGGGGGGATTCATGTTTGGCATATGCCTGCTCTGACCGAGATATTTGGGGATGATTCCGTACTA   [1199]
Noto_lei        TTGGGTGTCGCTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Noto_sub        TTGGGTGTCGCTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Viscum_al       TTGGGTGTCGCTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Viscum_ar       TTGGGTATCGCTACCAGGTGTTTTGCCCGTAGCTTCGGGAGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Antidaphn       TTGGGTCTCACTACCGGGTGTTTTACCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Eubrachio       TTGGGTCTCACTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATATTTGGGGATGATTCCGTACTA   [1200]
Lepidocer       TTGGGTCTCACTACCTGGTGTTTTGCCCGTCGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Osyris          TTGGGTCTCACTCCCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Comandra        TTGGGTCTCGCTACCAGGCGTTTTGCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTA   [1200]
Santalum        TTGGGTCTCACTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Exocarpos       TTGGGTCTCGCTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Pyrularia       TTGGGTCTCACTACCAGGCGTTTTACCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATTTTTGGGGATGATTCCGTACTA   [1200]
Buckleya        TTGGGTCTCGCTACCAGGCGTTTTACCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGATATCTTTGGGGATGATTCTGTATTA   [1200]
Jodina          TTGGGTCTCGCTACCCGGCGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Acanthosyris    TTGGGTCTCGCTACCCGGCGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Thesium         TTGGGTCTCGCTACCAGGCGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Agonandra       TTGGGTCTCGCTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Cansjera        TTGGGTCTCGCTACCAGGTGTTATACCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATGCCGTACTA   [1200]
Champerei       TTGGGTCTCGCTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATGCCGTACTA   [1200]
Opilia          TTGGGTCTCGATACCAGGTGTTCTGCCCGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATGCCGTACTA   [1200]
Misodendr       TTGGGTCTCGCTGCCAGGTGTTTTGCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTCCTT   [1200]
Gaiadendr       TTGGGTTTCGCTACCTGGTGTTTTGCCTGTAGCTTCCGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTA   [1200]
Moquinell       TTGGGTTTCGCTACCGGGTGTTTTGCCCGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTA   [1200]
Tupeia          TTGGGTTTCGCTACCGGGTGTTTTGCCCGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTA   [1200]
Strombosi       TTGGGTTTCGATGCCAGGTGTTATACCCGTGGCTTCGGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Minquarti       TTGGGTCTCGCTACCAGGTGTTTTGCCCGTAGCTTCGGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA   [1200]
Heisteria       TTGGGTCTCGCTCCCAGGTGTTCTGCCCGTAGCTTCGGGAGGTATTCACGTTTGGCATATGCCCGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTC   [1200]
Ximenia         TTGGGTCTCGTTGCCAGGCGTTATACCCGTAGCTTCGGGGGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGATTCCGTACTA   [1200]
Olax            TTGGGTCTCCTTACCAGGCGTTTTACCCGTAGCTTCGGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAAATCTTTGGGGATGATTCCGTACTA   [1200]
Schoepfia       TTGGGTCTCGCTACCGGGTGTTTTGCCCGTAGCTTCAGGGGGTATTCATGTGTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTA   [1200]

[                        1210      1220      1230      1240      1250      1260      1270      1280      1290      1300]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           CAATTCGGTGGAGGAACTTTAGGGCACCCTTGGGGAAATGCACCTGGTGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Arceu_ver       CAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCGGGTGCCATATCTAATCGAGTAGCTTTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Dendro_cl       CAGTTCGGTGGAGGAACCTTGGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTCGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAGG   [1300]
Phorad_se       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTCGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAGG   [1300]
Phorad_ca       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATTCGCCGGGTGCCGTAGCTAATCGAGTCGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAGG   [1300]
Korth_lat       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCAGGTGCCGTAGCTAATCGAGTCGCTCTAGAAGCATGTGTACAAGTTCGTAATGAGG   [1300]
Korth_lin       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCAGGTGCCGTTGCTAATCGAGTCGCTCTAGAAGCATGTGTACAAGTTCGTAATGAGG   [1300]
Ginalloa        CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCAGGTGCCGTAGCGAATCGAGTCGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1299]
Noto_lei        CAGTTCGGGGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCTGTAGCTAATCGAGTTGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Noto_sub        CAGTTCGGGGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCTGTAGCTAATCGAGTTGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Viscum_al       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTCGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Viscum_ar       CAGTTTGGTGGAGGAACCTTAGGACATCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTCGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Antidaphn       CAGTTCGGTGGAGGAACCTTAGGACACCCCTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Eubrachio       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCCGRTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Lepidocer       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATCGACCAGGTGCCGTAGCTAATCGAGTCGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Osyris          CAATTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCCCGTAATGAGG   [1300]
Comandra        CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGCAATGAGG   [1300]
Santalum        CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCAGGCGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Exocarpos       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCAGGTGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Pyrularia       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCCCGTAATGAGG   [1300]
Buckleya        CAATTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Jodina          CAGTTCGGTGGAGGAACCCTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTAATGAGG   [1300]
Acanthosyris    CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTGGCTCTAGAAGCGTGTGTACAAGCTCGTAATGAGG   [1300]
Thesium         CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Agonandra       CAGTTCGGTGGAGGAACCTTAGGACACCCTTTGGGAAATTCACCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTCCAAGCTCGTAATGAGG   [1300]
Cansjera        CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTCAAAGCTCGGAATGAGG   [1300]
Champerei       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGAAAATGCACCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCTTGTGTCCAAGCTCGTAATGAGG   [1300]
Opilia          CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCACCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTCCAAGCTCGTAATGAGG   [1300]
Misodendr       CAGTTCGGTGGAGGAACTTTAGGACACCCTTTGGGAAACGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Gaiadendr       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Moquinell       CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Tupeia          CAGTTCGGTGGAGGAACCTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Strombosi       CAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Minquarti       CAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Heisteria       CAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCTGTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Ximenia         CAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCGCGTAATGAGG   [1300]
Olax            CAGTTCGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCGCCGGGTGCCGTAGCCAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]
Schoepfia       CAGTTCGGTGGAGGAACCTTAGGGCACCCTTGGGGAAATGCACCGGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAGG   [1300]

[                        1310      1320      1330      1340      1350      1360      1370      1380      1390      1400]
[                        .         .         .         .         .         .         .         .         .         .]

Alnus           GACGTGATCTTGCTCGTGAGGGTAATGAAATTATTCGTGAGGCTGCTAAATGGAGTCCTGAGCTAGCTGCCGCTTGTGAAGTATGGAAGGAGATCAAATT   [1400]
Arceu_ver       GACGGGATTTAGCTCGTGAGGGTAATGACATTATACATGAGGCTACTAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATT   [1400]
Dendro_cl       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTATGGAAAGAGATTAAATT   [1400]
Phorad_se       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTATGGAAAGAAATCAAATT   [1400]
Phorad_ca       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTATGGAAAGAGATCAAATT   [1400]
Korth_lat       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATT   [1400]
Korth_lin       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTATGGAAAGAGATCAAATT   [1400]
Ginalloa        GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTATGGAAAGAGATCAAATT   [1399]
Noto_lei        GGCGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCAGAATTAGCTGCTGCTTGTGAGGTATGGAAAGAGATCAAATT   [1400]
Noto_sub        GCGG-GATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAAGCTAGCAAATGGAGTCCAGAATTAGCTGCTGCTTGTGAGGTATGGAAAGAGATCAAATT   [1399]
Viscum_al       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAAGTATGGAAAGCGATCAAATT   [1400]
Viscum_ar       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATTCGCGAGGCTAGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAGGTATGGAAAGMGATCAAATT   [1400]
Antidaphn       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATTCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Eubrachio       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Lepidocer       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTCGCTGCGGCTTGTGAAGTATGGAAGGAGATAAAATT   [1400]
Osyris          GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Comandra        GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTGCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATAAAATT   [1400]
Santalum        GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Exocarpos       GACGGGATCTTGCTCGCGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAAATCAAATT   [1400]
Pyrularia       GACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Buckleya        GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Jodina          GACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCCGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Acanthosyris    GACGGGATCTTGCTCGTCAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATT   [1400]
Thesium         GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Agonandra       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGCGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAAGAGATCAAATT   [1400]
Cansjera        GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGCGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGCGAGGTATGGAAAGAGATCAAATT   [1400]
Champerei       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGCGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Opilia          GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Misodendr       GACGGGATCTTGCTCGTGAGGGTAACGAAATTATCCGCGAGGCTCGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAAGAGATCAAATT   [1400]
Gaiadendr       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGCGAGGCTCGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Moquinell       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATCCGCGAGGCTTGCACATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATATGGAAGGAGATCAAATT   [1400]
Tupeia          GACGGGATCTTGCTCGTGAGGGTAATGATATTATCCGCGAGGCTTGCACATGGAGTCCTGAACTAGCTGCTGCTTGTGAGATATGGAAGGAGATCAAATT   [1400]
Strombosi       GACGCGATCTTGCTCGTGAGAGTACTGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Minquarti       GACGTGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAGTT   [1400]
Heisteria       GACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGTCCTGAACTAGCGGCTGCTTGTGAGGTCTGGAAGGAGATCAAATT   [1400]
Ximenia         GACGTGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAGTGGAGTCCTGAACTCGCTGCTGCTTGTGAGGTATGGAAGGAGATCAAATT   [1400]
Olax            GACGTGATCTTGCTCGTGAGGGTAATGAAATTATCCGTGCGGCTAGCAAATGGAGTCCTGAACTAAATGCTGCTTGTGAGGTGTGGAAAGAGATAAAATT   [1400]
Schoepfia       GACGGGATCTTGCTCGTGAGGGTAATGAAATTATTCGTGAGGCTCGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAGGTATGGAAGGAAATCAAATT   [1400]

[                        1410      1420      1430      ]
[                        .         .         .         ]

Alnus           TGAA---TTCCCAGCAATGGATACTTTG---------TA   [1427]
Arceu_ver       TGAA---TTTGAAGCCATGGATAC?TTG---------TA   [1427]
Dendro_cl       TGAA---TTTCAAGCAGTGGATAC?TTG---------TA   [1427]
Phorad_se       TGAA---TTTCAAGCAATGGATACTTTG---------TA   [1427]
Phorad_ca       TGAA---TTTCAAGCAGTGGATACTTTG---------TA   [1427]
Korth_lat       TGAA---TTTCCAGCAATGGATACTTTG---------TA   [1427]
Korth_lin       TGAA---TTTCCAGCAATGGATACTTTG---------TA   [1427]
Ginalloa        TGAA---TTTCCAGCAATGGATACTTTG---------TA   [1426]
Noto_lei        TGAA---TTTCAAGCAATGGATACTTTA---------TA   [1427]
Noto_sub        TGAA---TTTCAAGCAATGGATACTTTA---------TA   [1426]
Viscum_al       TGAA---TTTGCCGCAGTGGATAC?TTG---------TA   [1427]
Viscum_ar       TGAA---TTTGCCGCAGTGGATACTTTG---------TA   [1427]
Antidaphn       TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
Eubrachio       TGAA---TTCGAAGCAATGGATACCTTG---------TA   [1427]
Lepidocer       TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
Osyris          TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
Comandra        TATA---TTCCCAGCAATGGATACTTTG---------TA   [1427]
Santalum        TGAA---TTCGAAGCAATGGATAC?TTG---------TA   [1427]
Exocarpos       TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
Pyrularia       TGAA---TTCCAAGCAATGGATACTTTG---------TA   [1427]
Buckleya        TGAA---TTCCAAGCAATGGATACTTTG---------TA   [1427]
Jodina          TGAA---TTCCAAGCAATGGACACTTTG---------TA   [1427]
Acanthosyris    TGAA---TTCCAAGCAATGGACACTTTG---------TA   [1427]
Thesium         TGAA---TTCCAAGCAATGGATACTTTG---------TA   [1427]
Agonandra       TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
Cansjera        TGAA---TTTGAAGCAGTGGATACTTTG---------TA   [1427]
Champerei       TGAA---TTTGAAGCAATGGATACTTTG---------TA   [1427]
Opilia          TGAA---TTTGAAGCAGTGGATAC?TTG---------TA   [1427]
Misodendr       TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
Gaiadendr       TGAA---TTCCAAGCAATGGATACTTTG---------TA   [1427]
Moquinell       TGAA---TTCCAAGCAATGGATACTTTG---------TA   [1427]
Tupeia          TGAA---TTCCAAGCAATGGATACTTTG---------TA   [1427]
Strombosi       TGAA---TTCCAAGCAGTGGATACTTTGGACAAG---TA   [1433]
Minquarti       TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
Heisteria       TGAA---TTCGAAGCAGTGGATACTTTGGATAAATAGTA   [1436]
Ximenia         TGAA---TTCGAAGCAGTGGATACTTTG---------TA   [1427]
Olax            TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
Schoepfia       TGAA---TTCGAAGCAATGGATACTTTG---------TA   [1427]
;
END;